Stem Cells
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


First published online April 19, 2007
Stem Cells Vol. 25 No. 8 August 2007, pp. 1862 -1871
doi:10.1634/stemcells.2006-0700; www.StemCells.com
© 2007 AlphaMed Press

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2006-0700v1
25/8/1862    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Riccioni, R.
Right arrow Articles by Testa, U.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Riccioni, R.
Right arrow Articles by Testa, U.

CANCER STEM CELLS

Expression of Tie-2 and Other Receptors for Endothelial Growth Factors in Acute Myeloid Leukemias Is Associated with Monocytic Features of Leukemic Blasts

Roberta Riccionia, Daniela Diveriob, Gualtiero Mariania, Sonia Buffolinob, Viviana Ritia, Ernestina Saulleb, Eleonora Petruccia, Michele Cedronec, Francesco Lo-Cocod, Robin Foàb, Cesare Peschlea, Ugo Testaa

aDepartment of Hematology, Oncology and Molecular Medicine, Istituto Superiore di Sanità, Rome, Italy;
bDepartment of Cellular Biotechnologies and Hematology, University La Sapienza, Rome, Italy;
cHematology Section, Ospedale San Giovanni, Rome, Italy;
dDepartment of Biopathology, University Tor Vergata, Rome, Italy

Key Words. Tie-2 • Angiopoietins • Vascular endothelial growth factor • Acute myeloid leukemia • Endothelial cells

Correspondence: Ugo Testa, M.D., Department of Hematology, Oncology and Molecular Medicine, Istituto Superiore di Sanità, Viale Regina Elena 299, 00161 Rome, Italy. Telephone: 00390649902422; Fax: 00390649387087; e-mail: u.testa{at}iss.it

Received on November 6, 2006; accepted for publication on March 28, 2007.

First published online in STEM CELLS EXPRESS  April 19, 2007.

    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 Acknowledgments
 References
 
We investigated the expression of Tie-2 in primary blasts from 111 patients with acute myeloid leukemia (AML) to evaluate a possible linkage between the expression of this receptor and the immunophenotypic and biologic properties of leukemic blasts. Tie-2 was expressed at moderate and high levels in 39 and 23 of 111 AMLs, respectively. The analysis of the immunophenotype clearly showed that Tie-2 expression in AML was associated with monocytic features. Interestingly, Tie-2 expression on AML blasts was associated with concomitant expression of other receptors for endothelial growth factors, such as vascular endothelial growth factor receptor 1 (VEGF-R1), -R2, and -R3. Tie-2+ AMLs were characterized by high blast cell counts at diagnosis, a high frequency of Flt3 mutations, and increased Flt3 expression. The survival of Tie-2+ AMLs is sustained through an autocrine pattern involving Angiopoietin-1 and Tie-2, as suggested by experiments showing induction of apoptosis in Tie-2+ AMLs by agents preventing the binding of angiopoietins to Tie-2. Finally, the in vitro growth of Tie-2+ AMLs in endothelial culture medium supplemented with VEGF and angiopoietins resulted in their partial endothelial differentiation. These observations suggest that Tie-2+ AMLs pertain to a mixed monocytic/endothelial lineage, derived from the malignant transformation of the normal counterpart represented by monocytic cells expressing endothelial markers. The autocrine angiopoietin/Tie-2 axis may represent a promising therapeutic target to improve the outcome of patients with monocytic AML.

Disclosure of potential conflicts of interest is found at the end of this article.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 Acknowledgments
 References
 
Concurrent with the identification of vascular endothelial growth factor (VEGF) and its membrane receptors (VEGF-R1, -R2, and -R3), two additional receptors known as the Tie receptors, Tie-1 and Tie-2 (Tie-2 is also referred to as Tek), were isolated from endothelial cells [1, 2], although these receptors have been classified as a different subfamily on the basis of differences in their domain structure. Subsequent studies have shown that these receptors, particularly Tie-2, bind a peculiar type of ligands known as angiopoietins. Studies on endothelial cells have suggested different biologic effects of these ligands: thus, Angiopoietin-1 (Ang-1) functions as an agonistic ligand for Tie-2, whereas Ang-2 seems to act as an antagonist [3, 4].

In addition to their expression in endothelial cells, Tie-1 and Tie-2 have been detected in several hemopoietic cell types, suggesting a possible function for these receptors in hemopoietic development (reviewed in [5]). However, gene knockout experiments have shown that Tie-2, but not Tie-1, is required for hematopoiesis [6, 7]. Tie-2-null embryos cannot give rise to definitive hemopoietic cells [7], thus suggesting that Tie-2 is required during early hematopoiesis. The examination of the ability of cells doubly deficient for Tie-1 and Tie-2 to contribute to blood lineages in chimeric mice has clearly shown that these receptors are specifically required during postnatal bone marrow hematopoiesis [8]. The effects of Tie-2 on adult hematopoiesis are exerted at both stem cell and progenitor levels: (a) at the stem cell level, Tie-2/Ang-1 promote the adhesion of stem cells to bone and maintain the quiescence of these cells [9]; (b) at the progenitor level, Ang-1 can promote the adhesion of Tie-2-expressing cells to fibronectin present on the surface of endothelial cells, enhancing proliferation of hemopoietic progenitor cells [7]; and (c) at the stem cell and progenitor levels, Tie-2 and angiopoietins have been implicated in recruitment and mobilization of these cells from bone marrow [10]. Furthermore, the expression and activation of Tie-2 contribute to the interplay between regenerating bone marrow neovessels and hematopoietic progenitors, leading to the rapid reconstitution of hematopoiesis after myelosuppression [11].

In addition to these findings, other studies have shown that Tie receptors are expressed on differentiated hemopoietic cells. Tie-1 was found to be expressed on the majority of CD34+ hemopoietic cells, and its expression is lost during the differentiation to the different hemopoietic lineages, with the exception of a subset of megakaryocytes [12]. The expression of Tie-2 was mostly explored at the level of hemopoietic progenitors. Approximately 10%–20% of adult bone marrow [13] or cord blood [14] hemopoietic progenitor cells expressed Tie-2 on their surface. At the level of mature blood elements, Tie-2 is expressed only by a subset of blood monocytes [15, 16]: these monocytic elements define functionally competent cell populations capable of re-endothelialization [15] and of tumor vessel formation [16].

Histopathologic evaluation of microvessel density in the bone marrow of acute myeloid leukemia (AML) patients revealed a significant increase of angiogenesis in active disease in comparison to normal bone marrow or reconstituting hemopoietic cells obtained from patients in remission [17]. Tie-2 expression was explored in AMLs, showing that the majority of them express the mRNA encoding this membrane receptor [1820]. The Tie-2 mRNA seemed to be expressed in AMLs from all French-American-British (FAB) subtypes, with a preferential expression in the M2, M4, and M5 subsets [18, 19]. The level of Tie-2 mRNA expression [20] or Tie-2 protein expression as detected by immunohistochemistry in bone marrow sections [21] in AML blasts did not correlate with response to treatment. Finally, another study has suggested the existence of an autocrine loop of angiopoietins-Tie-2 in AML cells, which promotes the survival of leukemic cells through phosphatidylinositol 3-kinase activation [22].

In the present study, we explored Tie-2 expression at the protein level in AMLs, and we found that its expression correlated with monocytic features of blasts. Interestingly, Tie-2 expression was associated with concomitant expression in AML blasts of other endothelial growth factor receptors, such as VEGF-R1, -R2, and -R3. The in vitro growth of these AML cells in endothelial cell culture medium supplemented with VEGF, Kit ligand (KL), and Flt3 ligand resulted in their partial endothelial differentiation. These observations suggest that monocytic AMLs pertain to a mixed monocytic/endothelial lineage, seemingly derived from the malignant transformation of the normal counterpart represented by monocytic cells expressing endothelial markers.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 Acknowledgments
 References
 
Cells
Fresh leukemic blasts from 105 patients with AML, taken after informed consent was obtained, were isolated from either bone marrow or peripheral blood by Ficoll-Hypaque density gradient centrifugation and immediately processed. All patients were diagnosed at the Divisions of Hematology of the University La Sapienza, the University Tor Vergata, and the Hospital San Giovanni in Rome, Italy. Leukemias were classified by morphologic and cytochemical criteria according to the FAB classification (5% corresponded to M0, 18% to M1, 19% to M2, 10% to M3, 27% to M4, 20% to M5, and 1% to M6).

The following criteria have been adopted for the diagnosis of FAB M5 (acute monocytic leukemia): (a) 70%–80% of the leukemic cells are morphologically of the monocytic lineage, including monoblasts, promonocytes, and monocytes; (b) a percentage of CD14+ cells >40%; (c) a minor granulocytic component (<20%); (d) in FAB M5a, the percentage of monoblasts is predominant (>60%–70%); (e) in FAB M5b, the percentage of promonocytes and monocytes is predominant (>70%); and (f) the large majority of the leukemic population shows intense nonspecific esterase activity, inhibited by sodium fluoride.

All samples analyzed contained infiltration by more than 70% leukemic blasts. Approval for these studies was obtained from the institutional review board of the Istituto Superiore di Sanità, Rome, Italy. Informed consent was obtained in accordance with the Declaration of Helsinki. The NB4 promyelocytic cell line was grown in RPMI 1640 medium containing 10% fetal calf serum (FCS). For induction of granulocytic differentiation, either fresh acute promyelocytic leukemia (APL) blasts or NB4 cells were plated in fresh medium at a density of 0.5 x 106 cells per milliliter and grown for various numbers of days in the presence of 1 µM All Trans Retinoic Acid (Sigma-Aldrich, St. Louis, http://www.sigmaaldrich.com).

Immunophenotypic Analysis of Leukemic Cells
Analysis of cell surface antigens was performed by flow cytometry using a FACScan flow cytometer (Becton, Dickinson and Company, Bedford, MA, http://www.bd.com). The following antibodies directed to membrane antigens were used for standard immunophenotypic analysis of AML blasts: anti-CD3, -CD7, -CD11a, CD11b, -CD11c, -CD13, -CD14, -CD15, -CD18, -CD19, -CD33, -CD34, -CD36, -CD38, -CD41, -CD45, -CD61, -CD64, -CD71, -CD90, -CD116, -CD117, -CD123, -CD131w, -CD235, and -HLA-DR (all from Pharmingen [San Jose, CA]/Becton Dickinson). In addition, in this study we used the following monoclonal antibodies (mAbs) to characterize AML blasts: anti-VEGF-R1, -VEGF-R2, -VEGF-R3, -Tie-2, anti-macrophage-colony-stimulating factor receptor (-M-CSFR), -c-met, -insulin-like growth factor 1 receptor (-IGF-1R) (all purchased from R&D Systems Inc., Minneapolis, http://www.rndsystems.com), and -CD133 (Miltenyi Biotec, Bergisch Gladbach, Germany, http://www.miltenyibiotec.com). Anti-Flt3 mAb was purchased from Serotec (Oxford, U.K., http://www.serotec.com). Cells were labeled and analyzed as previously reported [23].

For quantitative evaluation of flt3 (CD135) expression, leukemic cells were incubated with phycoerythrin-labeled anti-CD135 and analyzed by flow cytometry. Cell fluorescence emission was evaluated maintaining a fixed photo multiplier tube voltage to allow a quantitative comparison between various samples. Fluorescence data were evaluated in terms of mean fluorescence intensity (MFI) and were calculated as the ratio between MFI observed in cells incubated with anti-CD135 mAb and the MFI observed for the cells incubated with control IgG. von Willebrand factor (vWF) expression was evaluated on cells fixed and permeabilized using a monoclonal antibody anti-human vWF (Dakopatts, Copenhagen, Denmark; http://www.dako.com).

Angiogenic Growth Factor Evaluation in Culture Supernatants of Leukemic Blasts
Leukemic blasts were grown in Stem Pro Medium (Gibco-BRL, Long Island, NY, http://www.gibcobrl.com) at a cell density of 5 x 105 cells per milliliter, containing 1 ng/ml KL (R&D Systems). After 7 days, culture supernatants were collected and evaluated for the concentration of four different angiogenic growth factors (VEGF-A, VEGF-C, Ang-1, and hepatocyte growth factor [HGF]) using sensitive and specific enzyme-linked immunosorbent assays purchased from R&D Systems. The limit of detection of these assays was 10–20 pg/ml. Controls were carried out in parallel to confirm the absolute specificity of these assays.

In Vitro Endothelial Differentiation
In some experiments, leukemic cells were grown at 500,000 cells per milliliter in Human Endothelial/SFM Basal Growth Medium (Gibco-BRL) supplemented with 5% FCS, 20 ng/ml human recombinant VEGF, and 25 ng/ml human recombinant Angiopoietin-1 (both cytokines from R&D Systems) in fibronectin-coated six-well culture dishes (Biocoat; Becton, Dickinson and Company, Franklin Lakes, NJ, http://www.bd.com). At regular intervals, the cells were evaluated for vitality, morphology, and endothelial cell differentiation.

Lectin Labeling and Uptake of Acetylated Low-Density Lipoprotein
To assess the ability of endothelial cells to bind Ulex europeus lectin and to incorporate Dil-acetylated low-density lipoprotein (Dil-Ac-LDL), cells were first incubated with 10 µg/ml Dil-Ac-LDL (Molecular Probes Inc., Eugene, OR, http://probes.invitrogen.com) in endothelial cell culture medium for 2 hours at 37°C; cells were washed three times, incubated with 1 µg/ml fluorescein isothiocyanate (FITC)-conjugated U. europeus lectin (Sigma-Aldrich), washed twice, and then analyzed for fluorescence emission by a flow cytometer (FACScan; BD Biosciences, San Diego, http://www.bdbiosciences.com).

Matrigel Assay
In vitro-grown AML blasts or human umbilical vein endothelial cells (HUVECs) were seeded onto 24-well tissue cultures plates coated with Matrigel (BD Biosciences) at a cell density of 50,000 or 200,000 cells per well. Cells were observed for capillary-like tube formation every 2 hours by visual microscopy with an inverted microscope at magnifications of x20 and x40.

Cell Apoptosis
In some experiments, leukemic blasts (5 x 105 cells per milliliter) were grown for 48 hours either in the absence (control) or in the presence of 5 µg/ml Tie-2/Fc (extracellular domain of human Tie-2 fused to Fc region of human IgG; R&D Systems) or 5 µg/ml of a neutralizing antibody goat anti-human Tie-2 (R&D Systems), and the proportion of apoptotic cells was evaluated by Annexin V binding assay using a kit from Pharmingen. FITC-conjugated Annexin V binds to phosphatidylserine, which is exposed on the cell surface in the early process of apoptosis.

RNA Extraction and Reverse Transcription-Polymerase Chain Reaction Analysis
Total RNA was extracted from leukemia cells using the RNeasy Mini kit (Qiagen, Hilden, Germany, http://www1.qiagen.com) according to the manufacturer's instructions. Two µg of total RNA was reverse-transcribed by Moloney murine leukemia virus reverse transcriptase (Invitrogen, Carlsbad, CA, http://www.invitrogen.com) with oligo(dT). The reverse transcription-polymerase chain reaction (RT-PCR) was normalized for ß2-microglobulin (amplification within the linear range was achieved by 23 PCR cycles: denaturation at 95°C for 30 seconds, annealing at 54°C for 30 seconds, and extension at 72°C for 45 seconds). To evaluate the expression of Tie-2, an aliquot of RT-PCR was amplified within the linear range by 40 PCR cycles (denaturation at 95°C for 1 minute, annealing at 60°C for 2 minutes, and extension at 72°C for 2 minutes, followed by 7 minutes at 72°C for final extension). Each sample was electrophoresed in 1.5% agarose gel, transferred onto Hybond-N (Amersham Pharmacia Biotech, Uppsala, Sweden, http://www.amersham.com) filter, and hybridized with a specific Tie-2 probe. The sequences of the oligonucleotide primers and probe for Tie-2 detection were as follows: sense, TGAAGTGGAGAGAAGGTCTGTG; antisense, CAGCCGAGGAGTGTGTAATGT; probe, GTGGTCCGAGCTAGAGTCAACACC. The sequences of oligonucleotide primers and probe for ß2-microglobulin detection were previously reported [24, 25].

Small Interfering Angiopoietin-1 RNA
For transient transfection, AML blasts were transfected with 180 nM small interfering RNA (siRNA) for Angiopoietin-1 (Stealth RNA; Invitrogen) using Lipofectamine 2000 transfection reagent (Invitrogen) according to the manufacturer's protocol. Control siRNA was purchased from Invitrogen. The cells were harvested 48 hours post-transfection, and the proportion of apoptotic cells was determined by the Annexin V binding assay. Angiopoietin-1 expression in cell lysates was determined by Western blotting using a polyclonal antibody anti-human Angiopoietin-1 (SC-6320; Santa Cruz Biotechnology Inc., Santa Cruz, CA, http://www.scbt.com).

Western Blot Analysis
To prepare total extracts, the cells were washed twice with cold phosphate-buffered saline and lysed on ice for 30 minutes with 1% Nonidet P40 lysis buffer (20 mM Tris-HCl pH 8.0, 137 mM NaCl, 10% glycerol, 2 mM EDTA) in the presence of 1 mM phenylmethylsulfonyl fluoride, 1 mM dithiothreitol, 1 mM sodium orthovanadate, 2 µg/ml leupeptin, and 2 µg/ml aprotinin. Cell debris was removed by centrifugation at 13,000 rpm for 10 minutes at 4°C, and protein concentration of supernatants was determined using the Bio-Rad protein assay (Richmond, CA, http://www.bio-rad.com). Aliquots of cell extracts containing 100 µg of total protein were resolved by 10% SDS-polyacrylamide gel electrophoresis under reducing and denaturing conditions and transferred onto Hybond-C extra nitrocellulose membrane (Amersham Pharmacia Biotech).

Filters were blocked for 1 hour at room temperature in 5% nonfat dry milk dissolved in TBS-T (10 mM Tris-HCl pH 8.0, 150 mM NaCl, 0.2% Tween 20) followed by incubation with primary antibodies. After washing in TBS-T buffer, the filters were incubated for 1 hour at room temperature in 5% nonfat dry milk dissolved in TBS-T containing a 1:4,000 dilution of corresponding peroxidase-conjugated secondary antibodies. Proteins were visualized with the enhanced chemiluminescence technique according to the manufacturer's instructions (Super Signal West Pico; Pierce, Rockford, IL, http://www.piercenet.com). Anti-Tie-2 mAb was purchased from Upstate Biotechnology (Lake Placid, NY, http://www.upstate.com), anti-VEGF-R2 mAb was purchased from Santa Cruz Biotechnology, and anti-actin was purchased from Oncogene Research Products (Cambridge, MA, http://www.oncogene.com) and used as loading control.

Statistical Analysis
The statistical significance of various parameters was evaluated by the Student t test.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 Acknowledgments
 References
 
Tie-2 and VEGF-R Expression in AMLs
Using a specific anti-CD202b mAb, the expression of Tie-2 in leukemic blasts derived from 111 patients with AML was investigated. Among these patients, Tie-2 was expressed in 62 of 111 cases. According to the reactivity of AML blasts with the anti-Tie-2 mAb, we classified these AMLs into three groups: Tie-2 (49 of 111), Tie-2+ (39 of 111), and Tie-22+ (23 of 111) (representative examples of these AMLs are reported in Figure 1A). Tie-2 AMLs displayed <5% Tie-2 positive cells, Tie-2+ AMLs exhibited 20%–50% Tie-2-positive cells, and Tie-22+ AMLs showed >50% Tie-2-positive cells; furthermore, the mean fluorescence intensity of Tie-2 labeling was higher in Tie-22+ than in Tie-2+ AMLs. Tie-2+ AML blasts were also CD14+-positive, as shown by double-labeling experiments (Fig. 1A, bottom panel).


Figure 1
View larger version (56K):
[in this window]
[in a new window]

 
Figure 1. Flow cytometry and reverse transcription-polymerase chain reaction analysis of Tie-2 expression in acute myeloid leukemias. (A): Flow cytometry analysis of Tie-2, VEGF-R2, and CD14 in six acute myeloid leukemias (AMLs) subdivided, according to the proportion of Tie-2-positive cells, into Tie-2, Tie-2+, and Tie-22+ and in purified normal monocytes (bottom panels). The fluorescence observed in cells incubated with a negative control are shown by a gray curve, whereas a white curve indicates the fluorescence of cells incubated with either anti-Tie-2, anti-VEGF-R2, or anti-CD14. For normal monocytes, a double labeling with anti-CD14 and anti-Tie-2 is shown (bottom panels). (B): top panels, reverse transcription-polymerase chain reaction analysis of Tie-2 mRNA in 22 of the 105 AML patients included in the present study. Middle and bottom panels, Western blot analysis of Tie-2 and VEGF-R2 protein in 10 AML samples. Beta-actin is also shown as a loading control. Abbreviations: ß2-m, ß2-microglobulin; KDR, kinase domain receptor; PE, phycoerythrin; VEGF-R, vascular endothelial growth factor receptor.

 
This categorization into three groups was validated by the analysis of Tie-2 protein by Western blot and RT-PCR analysis of Tie-2 mRNA levels: in fact, both of these analyses showed that Tie-22+ AMLs exhibit relatively high Tie-2 protein and mRNA levels, Tie-2 AMLs show low/absent Tie-2 protein and mRNA content and, finally, Tie-2+ AMLs display intermediate Tie-2 protein and mRNA levels (Fig. 1B). Interestingly, there is a good parallelism between Tie-2 protein and VEGF-R2 protein levels (Fig. 1B). Flow cytometry analysis of Tie-2 expression on purified normal monocytes provided evidence that these cells were positive for Tie-2 expression, exhibiting a mean fluorescence intensity of labeling lower than that observed in Tie-22+ AMLs (Fig. 1A).

The analysis of the expression of the three VEGF-Rs clearly showed a preferential expression of these receptors in Tie-2-positive AMLs and, particularly, in Tie-22+ AMLs, whereas undetectable or very low expression was observed in Tie-2 AMLs (Fig. 2). This observation suggests that some AMLs exhibit a coordinated expression of receptors for angiogenetic growth factors.


Figure 2
View larger version (30K):
[in this window]
[in a new window]

 
Figure 2. Expression of VEGF-Rs (VEGF-R1, VEGF-R2, and VEGF-R3) in acute myeloid leukemias subdivided into three groups (Tie-2, Tie-2+, and Tie-22+) according to the level of Tie-2 expression. VEGF-R expression was explored by flow cytometry and is expressed as percentage of positive cells. The differences in the percentages of VEGF-R1-, VEGF-R2-, and VEGF-R3-positive cells between the Tie-2 and Tie-2+ (p < .001) and between the Tie-2 and Tie-22+ (p < .001) patients were all significant. Abbreviation: VEGF-R, vascular endothelial growth factor receptor.

 
Immunophenotypic Analysis of Tie-2-Positive AMLs
Among AML patients, the frequency of occurrence of different leukemia subtypes (M0 to M7) showed a prevalence of M4, M5a, and M5b AMLs in patients Tie-2+ and Tie-22+ compared with Tie-2 patients: 50% of Tie-2+ AMLs were classified as pertaining to M4, whereas only 16% of Tie-2 AMLs were M4 (p < .05); 72% of Tie-22+ cases were M5b, whereas only 2% of Tie-2 AMLs were M5 (p < .01).

Interestingly, of the eight AML-M3 included in the present study, four were Tie-2, two were Tie-2+, and two were Tie-22+. It is of interest to note that Tie-2-positive APLs show, in addition to Tie-2 expression, the presence of other receptors for endothelial growth factors, such as VEGF-R1, -R2, and -R3 (Fig. 3). The in vitro treatment of these Tie-2-positive APLs with retinoic acid resulted in the induction of granulocytic maturation accompanied by the concomitant downmodulation of Tie-2 and other VEGF-Rs (Fig. 3A). A similar phenomenon was observed in the NB4 promyelocytic cell line (Fig. 3B). Furthermore, using the MTPR9 cell line (U937 cells transfected with the PML-RAR{alpha} gene under the control of the metallothionein promoter [26]), we showed that the induction of PML-RAR{alpha} expression by Zn2+ addition was accompanied by an increased Tie-2 expression, whereas the addition of retinoic acid to these cells induced a marked downmodulation of Tie-2 expression (data not shown).


Figure 3
View larger version (49K):
[in this window]
[in a new window]

 
Figure 3. Flow cytometry analysis of Tie-2 expression in acute promyelocytic leukemia. (A): Analysis of Tie-2 and vascular endothelial growth factor receptors (VEGF-Rs) in one representative case of M3 acute myeloid leukemia. The leukemic cells, fresh or after 4 days of culture in the presence of RA were labeled with anti-Tie-2 or anti-VEGF-Rs and analyzed by flow cytometry. (B): Flow cytometric analysis of Tie-2, CD11b, and CD15 in NB4 cells grown either in the absence (control) or in the presence of 1 µM RA for either 1 or 3 days. Abbreviations: d, day; KDR, kinase domain receptor; PE, phycoerythrin; RA, retinoic acid.

 
Given the preferential occurrence of M4 and M5 leukemias among Tie-2+ and Tie-22+ AMLs, we analyzed the immunophenotype of these leukemias, particularly with the aim of investigating whether Tie-2-positive AMLs disclosed a prevalence of monocytic markers as compared with Tie-2-negative AMLs. The results of this analysis reported in Figure 4 show that (a) a high percentage (17 of 22) of Tie-22+ and a moderate percentage (15 of 37) of Tie-2+ AMLs displayed >20% of CD14+ AMLs, whereas only a minority (3 of 46) of Tie-2 exhibit >20% of CD14+ cells (p < .01) (double-labeling experiments showed that leukemic blasts are usually double-positive for Tie-2 and CD14 [Fig. 1A]); (b) the myeloid/monocytic membrane markers CD11b and CD36 were preferentially expressed, with few exceptions, in Tie-2+ and, particularly, in Tie-22+ AMLs; (c) the three membrane receptors, M-CSFR, c-met, and IGF-IR, preferentially expressed in the monocytic cells at the level of the hemopoietic system, displayed, with few exceptions, a high proportion of positive cells among Tie-2+ and Tie-22+ AMLs, whereas they showed only a low reactivity among Tie-2 AMLs; and (d) the reactivity of both Tie-2 and Tie-2+/Tie-22+ AMLs with anti-CD34 and anti-CD133 mAbs was greatly heterogeneous, with some cases displaying a low proportion of positive cells and other cases a high proportion of positive cells: Tie-2-positive AMLs displayed the tendency to be less positive than Tie-2-negative AMLs for CD34 and CD133 antigens (Fig. 4).


Figure 4
View larger version (25K):
[in this window]
[in a new window]

 
Figure 4. Analysis of the immunophenotypic features of acute myeloid leukemias (AMLs) subdivided into three groups (Tie-2, Tie-2+, and Tie-22+) according to the level of Tie-2 expression. Membrane antigen expression was explored by flow cytometry, and the results are expressed as percentage of positive cells for CD14, CD11b, Ac133, CD34, CD36, M-CSFR, c-MET, and IGF-IR and as MFI for FLT3. The differences in the levels of CD14+, CD11b+, CD36+, M-CSFR+, c-met+, and IGF-IR+ cells between Tie-2 and Tie-2+ (p < .001), between Tie-2 and Tie-22+ (p < .001), and between Tie-2+ and Tie-22+ AMLs were significant; differences in Flt3 MFI levels between Tie-2 and Tie-2+ (p < .01), between Tie-2 and Tie-22+ (p < .001), and between Tie-2+ and Tie-22+ (p < .01) AMLs were significant; differences in Ac133+ cells between Tie-2 and Tie-2+, between Tie-2 and Tie-22+, and between Tie-2+ and Tie-22+ AMLs were not significant (p > .05); differences in CD34+ cells between Tie-2 and Tie-22+ (p < .05) AMLs were significant, but not those between Tie-2 and Tie-2+ or between Tie-2+ and Tie-22+ (p > .05). Abbreviations: IGF1-R, insulin-like growth factor 1-receptor; M-CSFR, macrophage-colony-stimulating factor receptor; MFI, mean fluorescence intensity.

 
Tie-2+ AMLs Display a High Cellularity at Diagnosis
The cellularity at diagnosis represents one of the important prognostic factors for AMLs [27]. The mean white blood cell (WBC) count in the whole population of leukemic patients here investigated was 83.1 ± 8.9 x 103 WBC per mm3, with 27% of the patients exhibiting at diagnosis >100 x 103 WBC per mm3. We therefore evaluated the WBC number at diagnosis in Tie-2, Tie-2+, and Tie-22+ AMLs, showing that both Tie-2+ (116.3 ± 16 x 103 WBC per mm3) and Tie-22+ (150.1 ± 21.9 x 103 WBC per mm3) patients had increased WBC compared with Tie-2 (37 ± 6.3 x 103 WBC per mm3) patients (p < .001). In spite this clear difference in WBC number between Tie-2-negative and Tie-2-positive AMLs, it is important to note that not all Tie-2+ and Tie-22+ AMLs displayed a high cellularity (Fig. 5).


Figure 5
View larger version (14K):
[in this window]
[in a new window]

 
Figure 5. WBC counts at diagnosis observed in 105 acute myeloid leukemia patients subdivided into three groups (Tie-2, Tie-2+, and Tie-22+) according to the levels of Tie-2 expression. Abbreviation: WBC, white blood cell(s).

 
Tie-2-Positive AMLs Frequently Display flt3 Mutations and Exhibit Elevated Levels of flt3 Expression
The level of flt3 expression, as evaluated by flow cytometry through the analysis of mean fluorescence intensity (Fig. 4), was clearly higher in Tie-22+ (47.6 ± 5.8) and Tie-2+ (29.8 ± 2.9) AMLs than in Tie-2 AMLs (17 ± 1.7) (the differences between Tie-2 and Tie-2+ [p < .01] and Tie-2 and Tie-22+ [p < .001] were significant).

As to the frequency of FLT3 gene alterations, 24% of Tie-2-negative AMLs displayed FLT3-ITD mutations, compared with 41% of Tie-2-positive AMLs (p < .05); 2.4% of Tie-2-negative AMLs exhibited FLT3-D835/6 mutations, compared with 12% of Tie-2-positive AMLs (p < .05). Together, these findings suggest that the FLT3 gene is more strongly expressed and more frequently mutated in Tie-2-positive AMLs compared with Tie-2-negative AMLs. As stated above, we have observed that four of eight AML-M3 were Tie-2-positive. Three of the four Tie-2-positive M3 AMLs displayed an FLT3-ITD mutation, whereas none of the four Tie-2-negative AMLs exhibited FLT3-ITD mutations.

Tie-2 Expression in AML and Frequent Genetic Alterations
Of the 111 AML patients analyzed, 8 were positive for inv 16, 1 for MLL fusion, 2 for AML1/ETO, and 1 for DEK/CAN; all of them were BCR/ABL-negative. Of interest, all inv 16-positive cells displayed myelomonocytic features, and five of eight were Tie-2-positive. The two AML1/ETO-positive AMLs were Tie-2-negative.

Tie-2-Positive AMLs Release Angiopoietin-1, Which Is Required for Their Survival
We evaluated the capacity of Tie-2-positive AMLs, compared with Tie-2-negative AMLs, to release Ang-1, the physiological stimulatory ligand of the Tie-2 receptor. To perform this analysis, we grew in vitro the leukemic blasts derived from 15 Tie-2-negative and 12 Tie-2-positive (six pertaining to the Tie-2+ and six to the Tie-22+ group) AMLs, and we then evaluated the level of Ang-1 detected in the cell culture supernatants using a sensitive immunoenzymatic assay (Fig. 6A). These patients were selected according to two main criteria: cell availability and the level of Tie-2 expression, as evaluated by flow cytometry. The results of this analysis provided clear evidence that Tie-2-positive AMLs release markedly higher Ang-1 levels than Tie-2-negative AMLs [2,368 ± 412 pg/ml versus 580 ± 126 pg/ml; p = .004]. Similarly, Tie-2-positive AMLs release more VEGF-A than Tie-2-negative AMLs [1,128 ± 157 pg/ml versus 365 ± 78 pg/ml; p = .04]. VEGF-C was undetectable in the culture supernatants of all AMLs tested (data not shown). In contrast, HGF was released at similar levels by Tie-2-positive and Tie-2-negative AMLs [2,616 ± 405 pg/ml versus 2,679 ± 512 pg/ml].


Figure 6
View larger version (29K):
[in this window]
[in a new window]

 
Figure 6. Analysis of the release of Angiopoietin-1 by AML blasts and of its functional role in the protection from apoptosis. (A): Evaluation of Ang-1, VEGF-A, and HGF levels in the culture supernatants of acute myeloid leukemia (AML) cells. Leukemic blasts derived from AML patients subdivided into Tie-2-negative and Tie-2-positive groups (the Tie-2-positive group includes 12 patients, 5 corresponding to the Tie-22+ and 7 to the Tie-2+ subgroups) were grown in vitro for 5 days, and culture supernatants were then collected and analyzed for Ang-1, VEGF-A, and HGF content using specific and sensitive enzyme-linked immunosorbent assays. The difference in Ang-1 levels was highly significant (p = .0004) between Tie-2 and Tie-2+ patients, the difference in VEGF-A levels was significant (p = .04) between the Tie-2 and Tie-2+ patients, and the difference in HGF level between the two groups of patients was not significant (p = .65). (B): Effect of the addition of agents able to block angiopoietins (Tie-2/Fc) or their binding to Tie-2 (goat anti-Tie-2) or the synthesis of Ang-1 (Ang-1 siRNA) on the induction of apoptosis. Panels a and b, AML blasts derived from five Tie-2 and five Tie-2+ AMLs were grown in vitro in either the absence (C) or the presence of 5 µg/ml Tie-2/Fc, goat IgG, or goat anti-Tie-2. After 4 days of in vitro culture, the proportion of apoptotic cells was determined by the annexin V binding assay. The difference in the frequency of apoptotic cells between C and Tie-2/Fc or C and goat anti-Tie-2 was highly significant in Tie-2+ (p < .01) but not in Tie-2 AMLs. Panel c, AML blasts derived from three Tie-2 and three Tie-2+ AMLs were either not treated or treated with 160 nM C siRNA (scrambled siRNA) or with 180 nM Ang-1 siRNA (Ang-1 siRNA). After 48 hours of treatment, the cells were harvested and processed for the evaluation of the percentage of apoptotic cells by Annexin V binding (mean values ± SEM observed in three separate experiments) and Ang-1 content by Western blotting (one representative experiment is shown in one Tie-2+ AML). Abbreviations: AML, acute myeloid leukemia; Ang1, Angiopoietin-1; C, control; HGF, hepatocyte growth factor; siRNA, small interfering RNA; VEGF, vascular endothelial growth factor.

 
To investigate a possible role of Ang-1 released by leukemic blasts in leukemic cell survival/proliferation, we analyzed the effect of Ang-1 neutralization on leukemic blasts cell survival. To this purpose, we cultured in vitro leukemic cells (derived from five Tie-2, two Tie-2+, and three Tie-22+ patients) either in the absence or in the presence of Tie-2/Fc (that binds to soluble Ang-1 preventing its binding to Tie-2) or of a neutralizing anti-Tie-2 antibody (that prevents the binding of Ang-1 to Tie-2) and we measured the effect on cell survival by measuring the rate of apoptosis with the annexin-V binding assay. The addition of either Tie-2/Fc or of a neutralizing anti-Tie-2 antibody induced a moderate but significant increase in the proportion of apoptotic cells in Tie-2+ but not in Tie-2 AMLs (Fig. 6B). The difference in the frequency of apoptotic cells between C and Tie-2/Fc or between C and goat anti-Tie-2 was highly significant in Tie-2-positive (p < .01) but not in Tie-2-negative AMLs (p > .05). Control goat IgG did not modify the proportion of apoptotic cells both in Tie-2+ and Tie-2 AMLs.

To further demonstrate a role for Angiopoietin-1 in the autocrine stimulation of Tie-2+ AMLs, we used an Angiopoietin-1 siRNA approach to knock down Ang-1 expression in AML blasts. Using this approach we have investigated six additional AML patients, three Tie-2 patients, and three Tie-2+ patients. The Ang-1 siRNA used by us was able to knock down Ang-1 expression, whereas a control, scrambled siRNA did not affect Angiopoietin-1 expression (a representative Western blot is shown in Fig. 6Bc). Ang-1 siRNA, but not scrambled siRNA, induced a significant increase in the proportion of apoptotic cells in Tie-2+, but not in Tie-2 AMLs (Fig. 6Bc). In contrast, the addition of a neutralizing anti-VEGF antibody to two Tie-2 and five Tie-2+ AMLs failed to induce apoptosis of leukemic blasts (data not shown).

In Vitro Endothelial-Like Differentiation of Tie-2-Positive AMLs
The analysis of the immunophenotypic features show that Tie-2-positive AMLs displayed both monocytic and endothelial markers. We then cultured these cells in endothelial cell culture medium supplemented with Ang-1 in combination with VEGF. The analysis of the morphological features of cells grown under these culture conditions showed that leukemic blasts survived and acquired an endothelial-like morphology after 2 weeks of culture when grown in the presence of endothelial growth factors (Fig. 7A). This phenomenon was consistently observed for seven Tie-22+ AMLs grown under endothelial cell culture conditions. In contrast, Tie-2-negative AMLs survived poorly when grown in this endothelial cell culture conditions and did not undergo endothelial cell differentiation (data not shown). In parallel, we evaluated the expression of a set of membrane antigens typically expressed on endothelial cells, including CD202b (Tie-2), CD309 (VEGF-R2), CD308 (VEGF-R1), CD310 (VEGF-R3), angiotensin converting enzyme (CD143), vascular endothelial-Cadherin (CD144), Podocalyxin, CD146 and Cripto-1. The expression of all these membrane antigens clearly increased during the in vitro culture of Tie-2-positive AML blasts under endothelial cell culture conditions (one representative experiment is shown in Fig. 7B). It is important to note that leukemic blasts undergoing endothelial differentiation continue to express the CD14 antigen, thus confirming their monocytic origin. Additional studies showed that AML blasts grown in vitro under endothelial cell culture conditions bind U. europeus lectin and are able to endocytose Dil-Ac-LDL but failed to express the von Willebrand factor (data not shown).


Figure 7
View larger version (39K):
[in this window]
[in a new window]

 
Figure 7. Morphological and immunophenotypic analysis of acute myeloid leukemia cells grown under endothelial cell culture conditions. (A): Analysis of cell morphology of acute myeloid leukemia (AML) blasts derived from one Tie-22+ AML before (day 0) and after 7 and 14 days of in vitro culture on fibronectin-coated plates in endothelial cell culture medium containing Ang-1 + vascular endothelial growth factor. Cytospin preparations of cell aliquots were stained with May-Grunwald Giemsa. Original magnification, x600. (B): Immunophenotypic analysis of cell membrane antigen expression of the cells shown in Figure 6. Cells grown as reported in the legend of Figure 6 were labeled with the following antibodies directly conjugated with phycoerythrin: irrelevant IgG, negative C; anti-CD34 (CD34); anti-Tie-2 (CD202b); anti-vascular endothelial growth factor receptor 2 (VEGF-R2) (CD309); anti-VEGF-R1 (CD308); anti-VEGF-R3 (CD310); anti-CD62e (CD62e); anti-vascular endothelial-Cadherin (CD144); anti-CD146 (CD146); anti-angiotensin converting enzyme (CD143); anti-CRIPTO-1; anti-CD14 (CD14); and anti-CD34 (CD34). Abbreviation: C, control.

 
Finally, in a last set of experiments, we evaluated the capacity of Tie-2 AML blasts grown under endothelial cell culture conditions to form tube-like structures when plated on Matrigel-coated plates. However, these experiments carried out on three Tie-2+ AMLs grown for either 1 or 2 weeks under endothelial cell culture conditions showed that these cells failed to form tube-like structures when plated on Matrigel, whereas HUVECs plated under the same conditions formed tube-like structures (data not shown).


    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 Acknowledgments
 References
 
Neoangiogenesis plays a crucial role in the growth of solid tumors and hematologic malignancies such as AML [17, 23]. Increased numbers of endothelial cells have been detected on histologic sections of bone marrow biopsies of AML patients compared with those with reactive disease [28]. Angiopoietin and its cellular receptor Tie-2, together with VEGF and its receptor VEGF-R2, have been implicated as the main endothelial pathways required for tumor vascularization [17, 23].

In the present study, we analyzed Tie-2 expression in 111 AML patients at the protein level with the particular aim of evaluating the phenotypic features of Tie-2+ AMLs. Our observations indicate that 59% of AML samples express Tie-2: in 22% of cases, Tie-2 expression was particularly pronounced. The analysis of the phenotypic features of Tie-2-positive AMLs provided clear evidence that the large majority of them express monocytic membrane markers (CD14, CD11b, CD36, M-CSFR) and pertain to the M4, M5a, and M5b FAB subtypes.

The high Tie-2 expression in AML was associated with a sustained proliferative activity of leukemic blasts, as suggested by the observation that the number of leukemic blasts observed at diagnosis in Tie-22+ AMLs (150 ± 21.9 WBC 109/l) was much higher than that in Tie-2 AMLs (37 ± 6.3 WBC 109/l). The reasons for the increased cellularity of Tie-2+ AMLs are unclear, but it could be at least in part related to the high frequency of Flt3 mutations among Tie-2+ AMLs. It is in fact known that Flt3 mutations are associated with a high cellularity of AMLs at diagnosis [29]. Furthermore, our findings are in line with previous studies showing that FLT3-/ITD is preferentially associated with myelomonocytic and monocytic leukemias [30]: notably, the immunophenotype of a considerable number of FLT3-/ITD patients with M1 or M2 FAB subtypes expressed monocytic markers [31]. Interestingly, we observed also that Tie-2+ AMLs have a significantly higher Flt3 level of expression than Tie-2 AMLs. This finding is in line with other studies showing that in AML, a significant correlation exists among Flt3 expression levels, blast cell count, and FAB subtypes, with the M5 subtype expressing the highest levels [32]. Finally, previous studies have shown that the large majority (i.e., >70%) of AMLs with a leukocyte count >100 x 103 cells per mm3 pertain to the M4/M5 FAB subtypes [27].

The high cellularity of Tie-2+ AMLs could be related also to an autocrine mechanism involving the production of Ang-1 by leukemic blasts. We showed that in fact: (a) leukemic cells (particularly those of Tie-2-positive AMLs) release Ang-1 and VEGF; and (b) incubation of AML blasts with agents able to inhibit the binding of angiopoietins to Tie-2 (by blocking soluble angiopoietins by the addition of soluble Tie-2/Fc, by blocking the Tie-2 receptor with an anti-Tie-2 blocking antibody, or by reducing endogenous Angiopoietin-1 production using a specific silencing siRNA) resulted in a moderate, but significant, increase of apoptosis. This observation suggests that the Tie-2/Ang-1 autocrine pathway could play a relevant role in the survival of Tie-2+ AMLs. In line with this observation, previous studies have shown that Angiopoietin-1/Tie-2 interaction in AMLs [19] and endothelial cells [33] stimulates phosphatidylinositol 3-kinase, an important signaling pathway involved in the control of cell survival and proliferation.

The simultaneous expression in Tie-2-positive AMLs of both monocytic and endothelial markers suggests a peculiar cellular origin of these AMLs. Recent studies have shown that endothelial cells could develop from hematopoietic stem cells through the monocytic lineage [34, 35]. Two populations of cells with the capacity to differentiate into endothelial cells from mononuclear cells in peripheral blood have been identified: CD14+ cells present in peripheral blood differentiate into endothelial cells that do not have a long-term survival. These cells have been termed early endothelial progenitor cells. On the other hand, cells derived from CD14 cells or cells showing a cobblestone appearance grow exponentially, survive longer, and are called outgrow endothelial cells or late endothelial progenitor cells [36, 37]. Studies in mice have clearly established that both endothelial cells and vascular mural cells originate from bone marrow CD11bbright and CD11bdim precursors, respectively [38]. Other studies have provided clear evidence that Tie-2 defines proangiogenic monocytes required for tumor vessel formation [16]. In addition to Tie-2, monocytes/macrophages are also known to express the receptors for other endothelial growth factors, such as VEGF-R1 [39, 40]. Finally, Kuwana et al. [41] showed that a unique cell progenitor population, called monocyte-derived multipotential cells, can be derived in vitro from circulating CD14+ cells and was able to undergo endothelial cell differentiation, in vitro under appropriate cell culture conditions. According to all these considerations, we therefore suggest that Tie-2 AML may originate from the malignant transformation of precursors common to both the monocytic and endothelial lineages. However, other studies failed to demonstrate a complete endothelial differentiation of monocytic cells since these cells, when grown in endothelial cell culture medium, did not form endothelial colonies, did not express the vWF, and did not form tube-like structures when plated on Matrigel-coated plates [4244].

In line with these observations, we observed that Tie-2 AMLs, under appropriate cell culture conditions (i.e., in the presence of macrophage-colony-stimulating factor) undergo macrophage differentiation, whereas in the presence of Ang-1 and VEGF in endothelial cell culture medium they undergo partial endothelial cell differentiation (i.e., they acquire several membrane endothelial cells makers, bind U. europeus lectin, and endocytose Dil-Ac-LDL, but they do not express vWF and fail to form tube-like structures when plated on Matrigel). Furthermore, a recent study provided evidence that M4 AMLs transplanted in immunodeficient mice generate a cell progeny expressing human endothelial markers [45].

It is of interest to note that a part (50%) of M3 AMLs also express Tie-2, as well as VEGF-Rs. This finding is complementary to previous studies showing an increased angiogenesis in bone marrow of APL patients [46], seemingly due to the high release of VEGF and HGF by leukemic promyelocytes [47, 48]. It is of interest to note that three of four AML-M3 patients exhibiting Tie-2 expression on leukemic blasts display a FLT3-ITD mutation, whereas none of the four M3 AML Tie-2-negative patients showed this mutation. On the other hand, we also showed that in vitro incubation of APL blasts with retinoic acid resulted in a marked downmodulation of Tie-2, as well as of the three VEGF-Rs, a finding complementary to a previous study showing that retinoic acid abrogated the capacity of APL blasts to release VEGF [46].


    DISCLOSURE OF POTENTIAL CONFLICTS OF INTEREST
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 Acknowledgments
 References
 
The authors indicate no potential conflicts of interest.


    ACKNOWLEDGMENTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 Acknowledgments
 References
 
This study was supported by a grant from the Italian Health Ministry (Progetto Oncotecnologico and Progetto sulle Cellule Staminali) to U.T.


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 Acknowledgments
 References
 

  1. Sato TN, Qin Y, Kozak CA et al. Tie-1 and tie-2 define another class of putative tyrosine kinase genes expressed in early embryonic vascular system. Proc Natl Acad Sci U S A 1993;90:9355–9358.[Abstract/Free Full Text]

  2. Maisonpierre PC, Goldfarb M, Yancopoulos GD et al. Distinct rat genes related profiles of expression define a TIE receptor tyrosine kinase family. Oncogene 1993;8:1631–1637.[Medline]

  3. Davis S, Aldrich TH, Jones PF et al. Isolation of angiopoietin-1, a ligand for the TIE-2 receptor, by secretion-trap expression cloning. Cell 1996;87:1161–1169.[CrossRef][Medline]

  4. Maisonpierre PC, Suri C, Jones FP et al. Angiopoietin-2, a natural antagonist for Tie-2 that disrupts in vivo angiogenesis. Science 1997;277:55–60.[Abstract/Free Full Text]

  5. Jones N, Iljin K, Dumont DJ et al. TIE receptors: New modulators of angiogenic and lymphangiogenic responses. Nature Rev Mol Cell Biol 2001;2:257–267.[CrossRef][Medline]

  6. Sato TN, Tozawa Y, Deutsch U et al. Distinct roles of the receptor tyrosine kinases Tie-1 and Tie-2 in blood vessel formation. Nature 1995;376:70–74.[CrossRef][Medline]

  7. Takakura N, Huang XL, Naruse T et al. Critical role of the TIE2 endothelial cell receptor in the development of definitive hematopoiesis. Immunity 1998;9:677–686.[CrossRef][Medline]

  8. Puri MC, Bernstein A. Requirement of the Tie family of receptor tyrosine kinases in adult but not fetal hematopoiesis. Proc Natl Acad Sci U S A 2003;100:12753–12758.[Abstract/Free Full Text]

  9. Arai F, Hirao A, Ohmujira M et al. Tie-2/angiopoietin-1 signaling regulates hematopoietic stem cell quiescence in the bone marrow niche. Cell 2004;118:149–161.[CrossRef][Medline]

  10. Hattori K, Dias S, Heissig B et al. Vascular endothelial growth factor and angiopoietin-1 stimulate postnatal hematopoiesis by recruitment of vasculogenic and hematopoietic stem cells. J Exp Med 2001;193:1005–1014.[Abstract/Free Full Text]

  11. Kopp HG, Avecilla ST, Hooper AT et al. Tie2 activation contributes to hemangiogenic regeneration after myelosuppression. Blood 2005;106:505–513.[Abstract/Free Full Text]

  12. Zetterberg E, Lundberg LG, Palmblad J. Expression of cox-2, tie-2 and glycodelin by megakaryocytes in patients with chronic myeloid leukaemia and polycythaemia vera. Br J Haematol 2003;121:497–499.[CrossRef][Medline]

  13. Kukk E, Wartiovaara U, Gunji Y et al. Analysis of Tie receptor tyrosine kinase in haemopoeitic progenitor and leukemia cells. Br J Haematol 1997;98:195–203.[CrossRef][Medline]

  14. Yuasa H, Takakaura N, Shimomura T et al. Analysis of human TIE2 function on hematopoietic stem cells in umbilical cord blood. Biochem Biophys Res Commun 2002;298:731–737.[CrossRef][Medline]

  15. Nowak G, Karrar A, Holmen C et al. Expression of vascular endothelial growth factor receptor-2 or Tie-2 on peripheral blood cells defines functionally competent cell populations capable of reendothelialization. Circulation 2004;110:3699–3707.[Abstract/Free Full Text]

  16. De Palma M, Venneri MA, Galli R et al. Tie2 identifies a hematopoietic lineage of proangiogenic monocytes required for tumor vessel formation and a mesenchymal population of pericyte progenitors. Cancer Cell 2005;8:211–216.[CrossRef][Medline]

  17. Hussong JW, Rodgers GM, Shami PJ. Evidence of increased angiogenesis in patients with acute myeloid leukemia. Blood 2000;95:309–313.[Abstract/Free Full Text]

  18. Watarai M, Miwa H, Shikami M et al. Expression of endothelial cell-associated molecules in AML cells. Leukemia 2002;16:112–119.[CrossRef][Medline]

  19. Muller A, Lange K, Gaiser T et al. Expression of angiopoietin-1 and its receptor TEK in hematopoietic cells from patients with myeloid leukemia. Leukemia Res 2002;26:163–168.[CrossRef][Medline]

  20. Loges S, Heil G, Bruweleit M et al. Analysis of concerted expression of angiogenic growth factors in acute myeloid leukemia: Expression of angiopoietin-2 represents an independent prognostic factor for overall survival. J Clin Oncol 2005;23:1109–1117.[Abstract/Free Full Text]

  21. Schliemann C, Bieker R, Padro T et al. Expression of angiopoietins and their receptor Tie2 in the bone marrow of patients with acute myeloid leukemia. Haematologica 2006;91:1203–1211.[Abstract/Free Full Text]

  22. Wakabayashi M, Miwa H, Shikami M et al. Autocrine pathway of angiopoietin-Tie2 system in AML cells: Association with phosphatidyl-inositol 3 kinase. Hematol J 2004;5:353–360.[CrossRef][Medline]

  23. Testa U, Riccioni R, Militi S et al. Elevated expression of IL-3R{alpha} in acute myelogenous leukemia is associated with enhanced blast proliferation, increased cellularity and poor prognosis. Blood 2002;100:2980–2988.[Abstract/Free Full Text]

  24. Ziegler SF, Bird TA, Schneringer JA et al. Molecular cloning and characterization of a novel receptor protein tyrosine kinase from human placenta. Oncogene 1993;8:663–670.[Medline]

  25. Nakajima-Iijima S, Hamada H, Reddy P et al. Molecular structure of the human cytoplasmic beta-actin gene: Interspecies homology of sequences in the introns. Proc Natl Acad Sci U S A 1985;82:6133–6137.[Abstract/Free Full Text]

  26. Grignani F, Ferrucci PF, Testa U et al. The acute promyelocytic leukemia-specific PML-RARalpha fusion protein inhibits differentiation and promotes survival of myeloid precursor cells. Cell 1993;74:423–431.[CrossRef][Medline]

  27. Greenwood MJ, Seftel M, Richardson C et al. Leukocyte count as a predictor of death during remission induction in acute myeloid leukemia. Leuk Lymphoma 2006;47:1245–1252.[CrossRef][Medline]

  28. Podar K, Anderson KC. The pathophysiologic role of VEGF in hematologic malignancies: Therapeutic implications. Blood 2005;105:1383–1395.[Abstract/Free Full Text]

  29. Kottaridis PD, Gale RE, Frew ME et al. The presence of a FLT3 internal tandem duplication in patients with acute myeloid leukemia (AML) adds important prognostic information to cytogenetic risk group and response to the first cycle of chemotherapy. analysis of 854 patients from the United Kingdom Medical Research Council AML10 and 12 trials. Blood 2001;98:1752–1759.[Abstract/Free Full Text]

  30. Thiede C, Steudel C, Mohr B et al. Analysis of FLT3-activating mutations in 979 patients with acute myelogenous leukaemia: Association with FAB subtypes and identification of subgroups with poor prognosis. Blood 2002;99:4326–4335.[Abstract/Free Full Text]

  31. Muñoz L, Aventin A, Villamor N et al. Immunophenotypic findings in acute myeloid leukemia with FLT3 internal tandem duplication. Haematologica 2003;88:637–645.[Medline]

  32. Kuchenbauer F, Kern W, Schoch W et al. Detailed analysis of FLT3 expression levels in acute myeloid leukemia. Haematologica 2005;90:1617–1625.[Abstract/Free Full Text]

  33. Kanda S, Miyata Y, Mockizuki Y et al. Angiopoietin 1 is mitogenic for culture endothelial cells. Cancer Res 2005;65:6820–6827.[Abstract/Free Full Text]

  34. Rehman J, Li J, Orschell CM et al. Peripheral blood "endothelial progenitor cells" are derived from monocyte/macrophage and secrete angiogenic growth factors. Circulation 2003;107:1164–1169.[Abstract/Free Full Text]

  35. Fujiyama S, Amano K, Uehira K et al. Bone marrow monocyte lineage cells adhere on injured endothelium in a monocyte chemoattractant protein-1-dependent manner and accelerate reendothelization as endothelial progenitor cells. Circ Res 2003;93:980–989.[Abstract/Free Full Text]

  36. Gulati R, Jevremovic D, Peterson TE et al. Diverse origin and function of cells with endothelial phenotype obtained from adult human blood. Circ Res 2003;93:1023–1025.[Abstract/Free Full Text]

  37. Hur J, Yoon CH, Kim HS et al. Characterization of two types of endothelial progenitor cells and their different contributions to neovasculogenesis. Arterioscler Thromb Vasc Biol 2004;24:288–293.[Abstract/Free Full Text]

  38. Yamada Y, Takakura N. Physiological pathway of differentiation of hematopoietic stem cell population into mural cells. J Exp Med 2006;203:1055–1065.[Abstract/Free Full Text]

  39. Casella I, Feccia T, Chelucci C et al. Autocrine-paracrine VEGF loops potentiate the maturation of megakaryocytic precursors through Flt1 receptor. Blood 2003;101:1316–1323.[Abstract/Free Full Text]

  40. Niida S, Kondo T, Hiratsuka S et al. VEGF receptor 1 signaling is essential for osteoclast development and bone marrow formation in colony-stimulating factor 1-deficient mice. Proc Natl Acad Sci U S A 2005;102:14016–14021.[Abstract/Free Full Text]

  41. Kuwana M, Okazaki Y, Kodama H et al. Endothelial differentiation potential of human monocyte-derived multipotential cells. STEM CELLS 2006;24:2733–2743.[Abstract/Free Full Text]

  42. Yoder MC, Mear LE, Prater D et al. Redefining endothelial progenitor cells via clonal analysis and hematopoietic stem/progenitor cell principals. Blood 2007;109:1801–1809.[Abstract/Free Full Text]

  43. Zhang SJ, Zhang H, Wei YJ et al. Adult endothelial progenitor cells from human peripheral blood maintain monocyte/macrophage function throughout in vitro culture. Cell Res 2006;16:577–584.[CrossRef][Medline]

  44. Venneri MA, De Palma M, Ponzoni M et al. Identification of proangiogenic TIE2-expressing monocytes (TEMs) in human peripheral blood and cancer. Blood 2007; [Epub ahead of print].

  45. Henschler R, Gottig S, Junghahn I et al. Transplantation of human acute myeloid leukaemia (AML) cells in immunodeficient mice reveals altered cell surface phenotypes and expression of human endothelial markers. Leuk Res 2005;29:1191–1199.[CrossRef][Medline]

  46. Kini AR, Peterson LC, Tallman MS et al. Angiogenesis in acute promyelocytic leukemia: Induction by vascular endothelial growth factor and inhibition by all-trans retinoic acid. Blood 2001;97:3919–3924.[Abstract/Free Full Text]

  47. Gutierrez NC, Lopez-Perez R, Hernandez JM et al. Gene expression profile reveals deregulation of genes with relevant functions in the different subclasses of acute myeloid leukaemia. Leukemia 2005;19:402–409.[CrossRef][Medline]

  48. Casorelli I, Tenedini E, Tagliafico E et al. Identification of a molecular signature for leukemic promyelocytes and their normal counterparts: Focus on DNA repair genes. Leukemia 2006;20:1978–1988.[CrossRef][Medline]





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2006-0700v1
25/8/1862    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Riccioni, R.
Right arrow Articles by Testa, U.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Riccioni, R.
Right arrow Articles by Testa, U.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
STEM CELLS THE ONCOLOGIST CME ALPHAMED PRESS JOURNALS