Stem Cells
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


First published online July 10, 2008
Stem Cells Vol. 26 No. 10 October 2008, pp. 2455 -2466
doi:10.1634/stemcells.2007-0876; www.StemCells.com
© 2008 AlphaMed Press

OPEN ACCESS ARTICLE
This Article
Free via Open Access: OA
Right arrow OA Abstract
Right arrow Full Text (PDF)
Right arrowOA All Versions of this Article:
2007-0876v1
26/10/2455    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Unger, C.
Right arrow Articles by Dilber, M. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Unger, C.
Right arrow Articles by Dilber, M. S.

EMBRYONIC STEM CELLS/INDUCED PLURIPOTENT STEM CELLS

Lentiviral-Mediated HoxB4 Expression in Human Embryonic Stem Cells Initiates Early Hematopoiesis in a Dose-Dependent Manner but Does Not Promote Myeloid Differentiation

Christian Ungera, Elerin Kärnerb, Alexandra Treschowa, Birgitta Stellana, Ulrika Felldina, Hernan Conchaa, Mikael Wendelb, Outi Hovattac, Alar Aintsa, Lars Ährlund-Richterd, M. Sirac Dilbera

aDepartment of Medicine, Karolinska University Hospital Huddinge, Karolinska Institutet, Stockholm, Sweden;
bCenter for Oral Biology, Institute of Odontology, Karolinska Institutet, Stockholm, Sweden;
cDepartment of Clinical Science, Intervention and Technology, Karolinska University Hospital Huddinge, Karolinska Institutet, Stockholm, Sweden,
dDepartment of Woman and Child Health, Karolinska University Hospital Solna, Karolinska Institutet, Stockholm, Sweden

Key Words. Embryonic stem cells • HoxB4 • Transcription factors • Gene therapy • Hematopoiesis

Correspondence: Correspondence: M. Sirac Dilber, M.D., Ph.D., Department of Medicine, M54, Karolinska Institutet, Karolinska University Hospital Huddinge, SE-14186 Stockholm, Sweden. Telephone: 46-8-585-83855; Fax: 46-8-711-7684; e-mail: Sirac.Dilber{at}ki.se

Received on October 24, 2007; accepted for publication on June 26, 2008.

First published online in STEM CELLS EXPRESS  July 10, 2008.


    ABSTRACT
 Top
 Footnotes
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Conclusion
 Disclosure of Potential...
 Acknowledgments
 References
 
The variation of HoxB4 expression levels might be a key regulatory mechanism in the differentiation of human embryonic stem cell (hESC)-derived hematopoietic stem cells (HSCs). In this study, hESCs ectopically expressing high and low levels of HoxB4 were obtained using lentiviral gene transfer. Quantification throughout differentiation revealed a steady increase in transcription levels from our constructs. The effects of the two expression levels of HoxB4 were compared regarding the differentiation potential into HSCs. High levels of HoxB4 expression correlated to an improved yield of cells expressing CD34, CD38, the stem cell leukemia gene, and vascular epithelium-cadherin. However, no improvement in myeloid cell maturation was observed, as determined by colony formation assays. In contrast, hESCs with low HoxB4 levels did not show any elevated hematopoietic development. In addition, we found that the total population of HoxB4-expressing cells, on both levels, decreased in developing embryoid bodies. Notably, a high HoxB4 expression in hESCs also seemed to interfere with the formation of germ layers after xenografting into immunodeficient mice. These data suggest that HoxB4-induced effects on hESC-derived HSCs are concentration-dependent during in vitro development and reduce proliferation of other cell types in vitro and in vivo. The application of the transcription factor HoxB4 during early hematopoiesis from hESCs might provide new means for regenerative medicine, allowing efficient differentiation and engraftment of genetically modified hESC clones. Our study highlights the importance of HoxB4 dosage and points to the need for experimental systems allowing controlled gene expression.

Disclosure of potential conflicts of interest is found at the end of this article.


    INTRODUCTION
 Top
 Footnotes
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Conclusion
 Disclosure of Potential...
 Acknowledgments
 References
 
Hematopoietic stem cells (HSCs) exhibit the property of self-renewal and the ability to differentiate into cells of all hematopoietic lineages. At present, these cells are widely used in clinical procedures such as bone marrow and peripheral blood stem cell transplantation. Therefore, HSCs have numerous potential clinical applications, and many investigators have been interested in studying strategies for HSC expansion.

Human embryonic stem cells (hESCs) represent a novel source for transplantable cells and a unique tool by which to examine early human development [1]. Compared with adult stem cells, pluripotent embryonic stem cells possess an extensive proliferative potential, as well as the capability of multilineage differentiation both in vitro and in vivo [2, 3]. For transplantation, hESC-derived HSCs demonstrate several advantages compared with HSCs from bone marrow or umbilical cord blood. Suitable donor bone marrow is often short in supply, and cord blood contains too low numbers of HSCs for treatment of adults. Both sources suffer from difficulties in expansion of the long-term repopulating HSCs. In contrast, hESCs can be expanded indefinitely and potentially provide an unlimited source for HSCs if proper differentiation protocols are defined.

Growth and transcription factors, regulating early development, can increase HSC activity [4, 5]. In particular, the transcription factor HoxB4, which is expressed during hematopoietic development in CD34+ subpopulations and is downregulated upon maturation toward committed blood cell precursors, is implicated in the self-renewal of definitive HSCs [6]. Transplantation of HoxB4-transduced bone marrow cells into lethally irradiated mice can restore the HSC pool to normal levels, whereas controlling bone marrow regenerates it to only 10% of normal values [7], which gives an in vivo repopulation advantage to murine HSCs within nominal ranges [79].

HoxB4 may represent a valuable tool for in vivo delivery of therapeutic genes, resulting in a selective growth advantage of the modified cells. A high number of gene-modified cells may be required to achieve a therapeutic effect, particularly if the corrected cells have no survival advantage themselves. Promising results from the mouse model, which demonstrated an improved engraftment in NOD/SCID mice, promoted the use of HoxB4 in human HSCs [10]. In vitro expansion of somatic and embryonic HSCs following exposure to modified HoxB4 protein is possible but does not provide in vivo engraftment advantages [11, 12].

Little is known concerning HoxB4 signaling, although recently a panel of possible target genes has been reported in mouse ESCs [13]. Overexpression of HoxB4 in these mouse embryonic stem cells (mESCs) improved the outcome and the engraftment of differentiating hematopoietic precursors [1416]. In hESC-derived HSCs it was demonstrated that retroviral transfer of HoxB4 resulted in a proliferative advantage in vitro, whereas neither improved blood colony formation nor engraftment was observed [17]. However, a recent report showed that stable transfection of HoxB4 into hESCs promoted HSC proliferation while increasing the functional blood cell forming capacity [18]. Different levels of HoxB4 expressed in these two studies could explain the variable results in colony forming capacity, as seen in the adult HSCs [19, 20]. Thus, the expression levels of HoxB4 might be the key to improving the yield and maturation of hESC-derived HSCs without perturbing final blood cell differentiation. However, it has not been determined whether different HoxB4 levels change the outcome of hESC-derived HSCs and whether enforced expression of HoxB4 affects other embryonic cell types appearing throughout the differentiation. Such information is crucial for future gene therapy applications.

Therefore, in this study we aimed to comparatively evaluate the effect of different ectopic HoxB4 expression levels on proliferation during embryoid body (EB) development and hematopoietic differentiation of hESCs. Furthermore, we assessed HoxB4 effects on germ layer development in vivo. hESCs were transduced with HoxB4-coexpressing lentiviral vectors designed to yield significantly different levels of expression. The HoxB4 levels obtained were carefully monitored during EB differentiation, and their effects on hematopoiesis and teratoma formation were analyzed.


    MATERIALS AND METHODS
 Top
 Footnotes
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Conclusion
 Disclosure of Potential...
 Acknowledgments
 References
 
Viral Vectors
Human genomic HoxB4 was cloned from extracted donor buffy coat DNA using following primers: upper primer, 5' GGATCCATAGGAGGGCTTTCGGAAACA 3', with the addition of a BamHI site (boldface); lower primer, 5' GGGGGAGGGCAGATAGATTT 3'. The gene, with intact start codon, was cloned into the pCR blunt II TOPO vector (Invitrogen AB, Stockholm, Sweden, http://www.invitrogen.com) and subcloned into pEGFP-C3 (Clontech, Palo Alto, CA, http://www.clontech.com) to produce a pEGFP-HoxB4 fusion plasmid.

One enhanced green fluorescence protein (EGFP)-expressing and two EGFP/HoxB4-coexpressing lentiviral vectors were used in this study. (a) The EGFP-expressing lentiviral backbone FG12 was kindly provided by Dr. Xiao-Feng Qin (California Institute of Technology, Pasadena, CA) [21]. (b) The EGFP-HoxB4 fusion gene was cloned into the FG12 backbone, replacing EGFP, and was called FG12, Ubiquitin C promoter, EGFP-HoxB4 fusion (FUGH). (c) For the second EGFP/HoxB4 vector, the extended 2A-linker (E2A) sequence from pSTA1/33 [22] was inserted between EGFP and HoxB4, creating the EGFP-E2A-HoxB4 fusion fragment, which was cloned into the FG12 backbone. This vector was called FUGE2AH. HoxB4 and E2A were sequence-verified in final plasmids. To imply functional aspects, we used following simplified names for the vectors: EGFPcontrol for FG12, HoxB4high for FUGH, and HoxB4low for FUGE2AH. Mouse stem cell virus (MSCV) vector containing an internal ribosome entry site and expressing murine HoxB4 and green fluorescent protein (GFP) from a single bicistronic mRNA was used as a control MSCV-HoxB4iresGFP (MSCV-HiG, created by M. Kyba and provided by G. Daley, Children's Hospital, Boston) [16].

Production and Concentration of Lentiviral Vectors Pseudotyped with VSV Glycoprotein
Viral vectors were produced by transient cotransfection of 6 µg of plasmid DNA: 1 µg of envelope plasmid pMDG harboring the gene encoding vesicular stomatitis virus glycoprotein (VSV-G), 2 µg of gag-pol plasmid pCMV{Delta}R8.91 (both plasmids provided by Dr. D. Trono, University of Geneva, Switzerland), and 3 µg of our transfer vector constructs into 500,000 293FT cells (Invitrogen). Lentiviral particle collection and titration were done as published [23]. Unconcentrated titers for the EGFPcontrol vector were in the range of 1–2 x 106 viral particles (VP) per milliliter, and HoxB4high as well as HoxB4low vectors produced ~300,000 VP per milliliter. Viral particles were 100x concentrated, resuspended in hESC-culture medium, and frozen at –80°C until further use.

Culture and Transduction of Human Cells
hESC lines H9 (WiCell Research Institute, Madison, WI, http://www.wicell.org), passages 40–90, and HS181 (Karolinska Institutet Stem Cell Network, Stockholm, Sweden), passages 40–53, with a normal karyotype were cultured on human feeders as published [24, 25]. For transductions, the lentiviral particle-containing hESC medium supplemented with 5 µg/ml Polybrene (Sigma-Aldrich Sweden AB, Stockholm, Sweden, http://www.sigmaaldrich.com) was added to 30%–50% confluent hESCs in 24-well plates and incubated overnight. Transduction rates of 20%–30% were obtained using a multiplicity of infection (MOI) ≥10. To obtain a high EGFP-expressing population of hESCs, the cells were sorted by fluorescence-activated cell sorting (FACS) using a FACSDiVa cell sorter (BD Biosciences, San Jose, CA, http://www.bdbiosciences.com). After 1 week, EGFP+ colonies were separated by UV microscopy and mechanical passaging.

HeLa cells (American Type Culture Collection, Manassas, VA, http://www.atcc.org) were cultured in Dulbecco's modified Eagle's medium (DMEM) containing GlutaMAX (Invitrogen) and 10% fetal bovine serum (FBS). For HoxB4 expression analysis, cells were transduced with less than one viral particle per cell (MOI <1) and FACS-sorted for EGFP. The human myelogenous leukemia K562 cell line (American Type Culture Collection) was cultured in RPMI 1640 (Invitrogen) supplemented with 10% FBS.

EB Formation of hESCs
EB formation was induced using modified standard protocols [26]. hESCs were removed from the culture dish by incubation with collagenase NB5 (1 mg/ml) for 5–8 minutes and mechanical scraping. Cell aggregates were transferred to bacterial culture dishes with differentiation medium consisting of DMEM-low glucose [27] containing GlutaMAX (Invitrogen), 15% FBS, and 1% nonessential amino acids.

Quantitative Reverse Transcription Polymerase Chain Reaction
Total RNA was extracted using the RNeasy Mini Kit (Qiagen, Qiagen AB, Solona, Sweden, http://www.qiagen.com) following the manufacturer's instructions. Two micrograms of total RNA was DNase-treated and subsequently reverse-transcribed using 100 units of SuperScript III reverse transcriptase, 200 ng of random primers, and RNase inhibitor (all from Invitrogen).

Quantitative reverse transcription polymerase chain reaction (Q-PCR) was carried out using an Applied Biosystems 7500 Fast Real-Time PCR system with ABI Prism (Applied Biosystems, Foster City, CA, http://www.appliedbiosystems.com). Reactions were performed using 80 ng of cDNA, TaqMan Universal PCR Master Mix, and primers for HoxB4 (1x Assays-on-Demand, Hs00256884_m1), Gata1 (Hs00231112_m1), stem cell leukemia factor (SCL) (Hs00268434_m1), vascular epithelium (VE)-cadherin (Hs00174344_m1), Iroquois homeobox 5 (Irx5) (Hs00373920_g1), Capsase8-associated protein 2 (FLASH) (Hs01594281_m1), and hydroxymethylbilane synthase (HMBS) (Hs00609297_m1) (all from Applied Biosystems). The reactions were run at 50°C for 2 minutes and 95°C for 10 minutes, followed by 50 cycles of 95°C for 15 seconds and 60°C for 40 seconds. The comparative threshold cycle method was used to analyze HoxB4, SCL, and GATA1 expression, calibrating the levels to the housekeeping gene HMBS.

Western Blots
Total protein extracted from H9, K562, and Hela cells was electrophoresed on a 10% precast gel (Bio-Rad, Sundbyberg, Sweden, http://www.bio-rad.com). Proteins were blotted onto polyvinylidene difluoride membranes (Bio-Rad), which were probed overnight with a rat anti-HoxB4 hybridoma supernatant (Developmental Studies Hybridoma Bank, Iowa City, IA, http://www.uiowa.edu/~dshbwww) followed by secondary horseradish peroxidase (HRP)-conjugated anti-rat IgG antibody (DakoCytomation, Glostrup, Denmark, http://www.dakocytomation.com) at a 1:2,000 dilution. Bound antibodies were detected using SuperSignal West Pico Chemiluminescent Substrate (Pierce, Rockford, IL, http://www.piercenet.com). Primary anti-actin antibody (Sigma-Aldrich) at 1:500,000, followed by secondary anti-mouse HRP (DakoCytomation) at 1:2,000, was used as a control.

Immunocytochemistry
Cells were fixed in paraformaldehyde (Sigma-Aldrich), washed three times, and permeabilized with phosphate-buffered saline (PBS) containing 1% bovine serum albumin and 0.1% Triton X-100. After blocking with 4% normal goat serum (DakoCytomation), the cells were incubated overnight at 4°C with primary mouse anti-human Oct-4 antibody (1:45; Chemicon, Temecula, CA, http://www.chemicon.com). Thereafter, the cells were washed with PBS and incubated for 1 hour at room temperature with Alexa Fluor 594-conjugated goat anti-mouse IgG (1:200; Molecular Probes, Eugene, OR, http://probes.invitrogen.com). After washing, the samples were mounted with Vectashield containing 4,6-diamidino-2-phenylindole (Vector Laboratories, Burlingame, CA, http://www.vectorlabs.com). Control experiments were performed by omission of the primary antibody and revealed neither nonspecific staining nor antibody cross-reactivity.

Flow Cytometry
A single-cell suspension was obtained by incubating the undifferentiated hESCs with TrypLE Express (Invitrogen) for 5–10 minutes at 37°C. EBs were treated for 20 minutes at 37°C in TrypLE Express on a slowly circulating wheel, centrifuged, resuspended in DMEM containing 2% FBS using a 23-gauge needle, and filtered through a 30-µm mesh (BD Biosciences). Cells (1–2 x 105) were incubated for 20 minutes at 4°C with the following fluorescent-labeled monoclonal antibodies: CD34-allophycocyanin (APC), CD117-Cy-Chrome, CD38-Phycoerythrin (PE), CD45-PE, CD31-PE (all from BD Biosciences), CD133-PE (Miltenyi Biotec, Bergisch Gladbach, Germany, http://www.miltenyibiotec.com), and corresponding isotype controls (all at 1:20). For detection of stage-specific embryonic antigen-3 (SSEA3), the primary antibody from Chemicon at 1:10, followed by a secondary APC-conjugated anti-rat Ig antibody (BD Biosciences) at 1:20, was used. Acquisition and analysis were performed with a FACSCalibur flow cytometer using CellQuest Pro (BD Biosciences) and FlowJo (Tree Star, Ashland, OR, http://www.treestar.com) software.

Colony-Forming Unit Assay
The cells were treated as described above to obtain a single-cell suspension. Human hematopoietic progenitor assays were performed by plating single-cell suspensions of EBs into Methocult GF+ H4435 medium (StemCell Technologies SARL, Göteborg, Sweden, http://www.stemcell.com). Cells were aliquoted in duplicate samples at 2.5 x 105 per plate, and a differential colony count was performed on the basis of morphological characteristics to identify specific blood colonies after 14 days. Individual colonies were aspirated from the plates, washed and cytospun on slides, fixed in methanol, and stained with May-Grünwald-Giemsa stain.

Teratoma Formation
Male C.B.-17/GbmsTac-scid-bgDF N7 mice (Department of Microbiology, Tumor and Cell Biology, Karolinska Institutet, Stockholm, Sweden), 6 weeks of age, were kept under isolator conditions with access to water and food ad libitum. H9 cells, passage 82/83, were harvested mechanically prior to implantation, and 1 x 105 cells were inoculated beneath the testicular capsule, as described [28]. The animals were sacrificed after 8 weeks, the teratomas were fixed in 4% neutral buffered formaldehyde overnight prior to dehydration through a graded series of alcohols to xylene. The tissues were embedded in paraffin, serially sectioned at 5 µm, and stained with hematoxylin-eosin. Normal, noninjected testes served as controls.

Ethical Permissions
This work was performed with permission of the Local Ethics Committee at Karolinska Institutet (114/00) and the Regional Committee of Stockholm for Animal Experimentation (S172-03 and N105/07).

Statistical Analysis
Flow cytometry and colony-forming unit data are expressed as mean ± SEM. Statistical significance was assessed using the unpaired Student's t test. Results were considered significant if p < .05. Q-PCR results were compared using two-way analysis of variance.


    RESULTS
 Top
 Footnotes
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Conclusion
 Disclosure of Potential...
 Acknowledgments
 References
 
Two Novel Lentiviral Vectors Express Differential Levels of HoxB4 in HeLa Cells
To express HoxB4 on different levels, three lentiviral constructs were prepared, the FG12 (named EGFPcontrol) vector, which expresses EGFP; the FUGH (named HoxB4high) vector, which expresses an EGFP-HoxB4 fusion gene; and the FUGE2AH (named HoxB4low) vector, which expresses an EGFP-E2A-HoxB4 fusion gene (Fig. 1A). Prior to transduction of hESCs, HeLa cells were used to evaluate the efficacy of our vectors. The EGFPcontrol vector yielded strong cytoplasmic EGFP expression, whereas the EGFP-HoxB4 fusion protein, as in HoxB4high, was restricted to the nucleus (Fig. 1B). In contrast, HoxB4low transduced cells showed cytoplasmic localization of EGFP, confirming separation from HoxB4 by the E2A-peptide-mediated cleavage.


Figure 1
View larger version (27K):
[in this window]
[in a new window]

 
Figure 1. Two novel lentiviral vectors coexpressing EGFP and genomic HoxB4 (coding sequence including its intron) expressed differential levels of HoxB4 in HeLa cells. (A): Map of the three self-inactivating lentiviral vectors, enhanced with the woodchuck hepatitis B virus RNA regulatory element (WRE), used to drive transgene expression from the human ubiquitin C promoter. Basic control vector FG12 (named EGFPcontrol) contained EGFP only. FUGH (named HoxB4high) contained EGFP-HoxB4 fusion gene. FUGE2aH (named HoxB4low) contained EGFP-E2A-HoxB4 fusion gene with an extended 2A peptide linker (E2A) inserted in-frame to separate the proteins after translation. (B): EGFP expression after transduction with the three vectors, showing the nucleus-bound EGFP-HoxB4 fusion protein from FUGH and the cytoplasmic EGFP expression from FG12 and FUGE2aH constructs. (C): Quantitative reverse transcription polymerase chain reaction analysis of HoxB4 expression in EGFP-sorted HeLa cells transduced with our constructs and the control retroviral construct MSCV-HiG using a multiplicity of infection <1 to ensure one insertion per cell. HoxB4 gene expression is presented as fold induction relative to expression in K562 (HoxB4 level in K562 = 1). (D): Western blot analysis of HoxB4 expression in sorted HeLa transduced with FG12 (EGFPcontrol), FUGH (HoxB4high), FUGE2aH (HoxB4low), and the retroviral control vector MSCV-HiG expressing murine HoxB4. K562 protein extract was used as positive control. Abbreviations: DAPI, 4,6-diamidino-2-phenylindole; EGFP, enhanced green fluorescent protein; FUGH, FG12, Ubiquitin C promoter, EGFP-HoxB4 fusion; GFP, green fluorescent protein; LTR, long terminal repeat; MSCV, mouse stem cell virus; UbC, human Ubiquitin C promoter; WRE, woodchuck hepatitis B virus RNA regulatory element or short woodchuck response element.

 
As an endogenous HoxB4 control, the human myelogenous leukemia cell line K562 was used to evaluate protein size and expression level. Furthermore, we compared HoxB4 expression of the MSCV-HiG retroviral vector [16] with that of our lentiviral vectors in EGFP-sorted HeLa cells. HoxB4 levels were evaluated using Q-PCR, after separate transduction with the lentiviral and MSCV-HiG vectors at MOI <1, ensuring one viral insertion per cell [29]. HoxB4, measured in gene-modified cells, was proportioned to K562 HoxB4 levels and is presented as fold expression thereof. HeLa and HeLa-EGFPcontrol cells had nondetectable levels of HoxB4, whereas the expression in HeLa-HoxB4high cells was 5-fold that of K562 cells, and HeLa-HoxB4low cells expressed a lower, 3.4-fold HoxB4 level (Fig. 1C). The MSCV-HiG retroviral vector expressed the highest HoxB4 level, ninefold that of K562.

The HoxB4 protein from the intron-containing DNA appeared correctly spliced in HoxB4low transduced cells, as indicated by a size similar to that of endogenous HoxB4 expressed in K562 and the ectopic mouse HoxB4 in HeLa transduced with MSCV-HiG (Fig. 1D). The size of the EGFP-HoxB4 fusion protein in HoxB4high was correct considering the addition of the 27-kDa EGFP protein.

High Levels of Stably Expressed HoxB4 in hESC Cultures Do Not Affect Undifferentiation Markers SSEA3 and Oct4
To characterize the expression of HoxB4 in hESCs, cells were separately transduced with the three vectors, their ectopic HoxB4 expression was quantified, and expression of pluripotency markers was analyzed to confirm their undifferentiated phenotype. Using concentrated lentiviral vectors, transduction rates of 20%–30% were obtained. The transduced hESCs were expanded and subsequently EGFP-sorted using FACS, before mechanically selecting mid-size polyclonal colonies with 40%–60% EGFP-expressing cells (Fig. 2A). This midway percentage allowed us to follow any increase or decrease in the percentage of modified cells during hESC expansion or EB differentiation. EGFP expression, after selection, was detected in approximately 40%–50% of all three modified H9 cell lines (Fig. 2B). Total RNA was extracted from three separate experiments, and HoxB4 expression was measured with Q-PCR. H9-HoxB4high cells showed an 18.4-fold and H9-HoxB4low cells a 1.5-fold HoxB4 level relative to K562 cells (Fig. 2C) (in mixed unmodified/modified populations), whereas HoxB4 expression was undetectable in unmodified H9 and H9-EGFPcontrol cells. Western blot analysis confirmed an overexpression of HoxB4 protein in H9 (Fig. 2D) and also visualized a significant expression of a second HoxB4 band from our HoxB4high vectors.


Figure 2
View larger version (36K):
[in this window]
[in a new window]

 
Figure 2. HoxB4 transduction into hESCs by VSV-G pseudotyped lentiviral vectors and analysis of undifferentiation markers Oct4 and SSEA3 in HoxB4-expressing H9 cells. (A): Schematic representation of transduction and selection of gene-modified hESCs to obtain mixed gene-modified/nonmodified populations. (B): Flow cytometric analysis of EGFP expression in undifferentiated H9 hESCs after gene modification and selection process as shown in (A). (C): Quantitative reverse transcription polymerase chain reaction analysis of HoxB4 expression in the different modified, mixed H9 cell populations. Gene expression is shown as fold induction of relative HoxB4 expression in K562 (HoxB4 level in K562 = 1). (D): Western blot analysis of HoxB4 expression in the unmodified and modified undifferentiated H9 populations. (E): Immunocytochemistry of HoxB4high cells demonstrated Oct4 expression in EGFP-HoxB4-coexpressing hESCs. (F): Analysis of the hESC marker SSEA3 by flow cytometry in unmodified and gated H9-HoxB4high and H9-HoxB4low cells. Abbreviations: DAPI, 4,6-diamidino-2-phenylindole; EGFP, enhanced green fluorescent protein; FACS, fluorescence-activated cell sorting; hESC, human embryonic stem cell; SSEA3, stage-specific embryonic antigen-3.

 
During the expansion of undifferentiated hESCs, the ratio of HoxB4-modified and unmodified cells did not change over several passages, indicating that overexpression of HoxB4 had no effect on proliferation. Twenty passages after transduction, immunostaining for intracellular Oct-4 demonstrated a positive signal in H9-HoxB4high cells (Fig. 2E), indicating no effect on H9. Furthermore, the surface antigen SSEA3, another marker for undifferentiated hESCs, was detected by flow cytometry in >80% of unmodified and HoxB4-overexpressing cells (Fig. 2F). Taken together, these findings suggest a persistent undifferentiated phenotype of HoxB4-expressing hESCs.

HoxB4 Levels During EB Differentiation in Modified and Nonmodified hESC
To better understand how HoxB4 was expressed from our constructs and control cells during the time of hematopoiesis, we quantified HoxB4 throughout the whole EB differentiation time. Figure 3A outlines the steps involved in EB formation and analysis. Although the proportion of H9-EGFPcontrol cells increased slightly toward day 21 (range, 61%–75%), the H9-HoxB4high and H9-HoxB4low transduced cells peaked at day 3 (65% and 45% respectively) and subsequently decreased to 27% and 22% at day 21 (Fig. 3B). In parallel to H9, transduced HS181-HoxB4high control cells had already diminished the percentage of EGFP-HoxB4 cells to very low levels at EB day 7 (data not shown), making further analysis unfeasible. Therefore, all results presented were obtained with H9 cells.


Figure 3
View larger version (20K):
[in this window]
[in a new window]

 
Figure 3. Ectopic and endogenous HoxB4 expression levels in unmodified and modified H9 cells throughout EB differentiation. (A): Schematic representation of EB differentiation, analysis performed, and time points taken to detect hematopoietic differentiation. (B, C): The percentage of EGFP-expressing cells in EBs was analyzed by flow cytometry (B), as was also the percentage of CD34+ cells in unmodified EB cells (C). (D, E): Gene expression analysis of HoxB4 in unmodified H9 cells (D) and mixed modified/unmodified H9 populations (E) during EB differentiation using quantitative reverse transcription PCR. HoxB4 gene expression is shown as fold induction relative to expression in K562 (HoxB4 level in K562 = 1). Mean ± SEM of three experiments is presented. (F): Final comparison of normalized HoxB4 expression in HoxB4-overexpressing H9 cells compared with endogenous HoxB4 in CD34+ unmodified EB cells, showing H9-HoxB4high levels above and H9-HoxB4low levels mostly below the endogenous control. HoxB4 expression in modified cells was normalized to the percentage of EGFP+ cells (B), and endogenous HoxB4 was normalized to the percentage of CD34+ cells in unmodified H9 EB cells (C). HoxB4 gene expression is shown as fold induction of relative expression in K562 (HoxB4 level in K562 = 1). Abbreviations: CFU, colony-forming unit; EGFP, enhanced green fluorescent protein; FACS, fluorescence-activated cell sorting; PCR, polymerase chain reaction.

 
The endogenous HoxB4 potentially expressed by unmodified CD34+ H9 cells (Fig. 3C) increased from undetectable levels to a 1.3-fold level relative to K562 at day 21 of EB differentiation (Fig. 3D). A similar increase was observed in H9-EGFPcontrol cells (Fig. 3E). In H9-HoxB4low cells, the HoxB4 levels increased threefold over time, ranging from 1.5-fold (day 0) to 4.5-fold (day 21) relative to K562 expression. Similarly, the H9-HoxB4high cells showed a 3–4-fold increase from 8.5-fold (day 0) to 35-fold (day 21) (Fig. 3E), indicating an increasing ubiquitin promoter activity at later developmental time points.

Because of potential FACS-induced stress-related changes in gene expression, and to eliminate this source of interference, we quantified HoxB4 RNA directly from mixed GFP+/GFP populations. To attain the HoxB4 levels expressed only in modified differentiated cells, the measured HoxB4 levels in total cells (Fig. 3E) were normalized to the known percentage of EGFP+ cells obtained by flow cytometry (Fig. 3B). Endogenous HoxB4 control levels were determined from CD34+ cells, normalizing total HoxB4 expression in differentiating unmodified cells (Fig. 3D) to the percentage of CD34+ cells (Fig. 3C). Finally, comparison of normalized HoxB4 in expressing cells (Fig. 3F) revealed that H9-HoxB4high cells expressed more than twice the levels of endogenous HoxB4 found in CD34+ EB cells at all differentiation time points. However, H9-HoxB4low cells expressed lower than endogenous levels of HoxB4 after EB day 3.

Analysis of Hematopoietic Markers and HoxB4 Target Genes During EB Differentiation Reveals Distinct Changes in Cells Expressing High or Low HoxB4 Levels
To detect developing hematopoietic cells, standard early and late markers (such as CD34, CD133, CD117, and CD45, CD38) were measured by flow cytometry at days 3, 7, 14, and 21 of EB formation from H9-HoxB4high and H9-HoxB4low cells (Fig. 4A). H9 and H9-EGFPcontrol cells were included as controls (overview in Fig. 3A).


Figure 4
View larger version (20K):
[in this window]
[in a new window]

 
Figure 4. Expression of hematopoietic surface markers during the time course of EB differentiation in human embryonic stem cells expressing endogenous, low, and high amounts of HoxB4. (A): Flow cytometric analysis of CD34, CD38, CD45, CD133, and CD117 hematopoietic surface markers in EGFP-gated EB cells at four different time points during EB differentiation in fetal bovine serum-containing medium without additional cytokines. Mean ± SEM is presented from at least three independent experiments. Unspecific binding was analyzed with appropriate isotype controls, and gates were set accordingly. (B): CD31 expression on CD34-gated EB cells in H9-HoxB4high and H9-HoxB4low cells was similar to that in unmodified H9 cells after 14 days of EB differentiation. One representative histogram from two experiments is shown. Abbreviation: EGFP, enhanced green fluorescent protein.

 
Unmodified H9 cells showed low but increased numbers of CD34+ and CD38+ cells during EB differentiation (day 21, 1.5% ± 0.05% and 0.4% ± 0.09%, respectively). The general hematopoietic marker CD45 was low at all time points. CD133 and the stem cell factor receptor CD117 were expressed in approximately 40%–50% of undifferentiated cells and slowly decreased to 20%–30% by day 21 (Fig. 4A). The H9-EGFPcontrol exhibited values similar to those of unmodified H9 cells.

Both CD34 and CD38 showed changes in H9-HoxB4high cells but not in H9-HoxB4low cells. H9-HoxB4high reached a significant amplification of CD34+ cell numbers (1.56% ± 0.4% vs. 0.112%; p = .0046) at EB day 7, increasing rapidly toward day 14. At this time, 6.4% ± 0.82% of H9-HoxB4high cells were CD34+ versus 0.86% ± 0.1% of unmodified cells (p < .0001). By day 21, a fast decrease of CD34+ cells (1.61% ± 0.116%) occurred in the H9-HoxB4high population, reaching levels of unmodified H9 cells. In addition, the frequency of CD34 in non-GFP-expressing EB cells of the mixed populations was compared with that of unmodified H9 EB cells, and no significant difference was found (data not shown). All unmodified H9 cells (in mixed or nonmixed situations) have therefore been considered similar, also indicating no indirect effects of HoxB4 overexpression on neighboring cells. CD38 was expressed by 2.56% ± 0.22% of H9-HoxB4high cells versus 0.12% ± 0.035% of unmodified H9 cells at day 14 (p < .004) and dropped only slightly toward day 21 (2.25% ± 0.34% vs. 0.4% ± 0.09% in unmodified H9; p < .0065). The frequency of CD45 cells showed an increasing trend toward day 14; however, there was no statistically significant change. CD117 and CD133 showed levels between 20% and 60% in both modified and unmodified cell populations throughout the whole observation period.

According to the literature, CD34+CD31+ hESC-derived cells may represent hematoendothelial cells [30]. We detected this phenotype and revealed no HoxB4-induced changes in CD31 expression of the gated CD34+ cells between HoxB4-modified and unmodified H9 cells (55%–60%) at EB day 14 (Fig. 4B).

Next, RNA levels of the hematopoietic transcription factors SCL and GATA1 were analyzed (Fig. 5A, 5B). The values are presented as the total in mixed populations. We detected a significant increase of SCL expression toward day 14 in H9-HoxB4high cells versus controls (185 ± 119 vs. 40.8 ± 4.5 respectively; p = .009), and GATA1 showed a nonsignificant increase (12.82 ± 6.077 vs. 1.167 ± 0.3383; p = .12). Furthermore, we found the hematoendothelial marker gene VE-cadherin to be significantly upregulated (Fig. 5C) in H9-HoxB4high cells at day 14 (1,218 ± 312.5 vs. 117.7 ± 9.3; p = .02) and day 21 (1,010 ± 252 vs. 317 ± 35.6; p = .05) of EB differentiation.


Figure 5
View larger version (15K):
[in this window]
[in a new window]

 
Figure 5. Quantitative reverse transcription polymerase chain reaction analysis of intracellular hematoendothelial marker genes SCL/TAL1 (A), GATA1 (B), VE-cadherin (C), and HoxB4 downstream targets Irx5 (D) and FLASH (E) during EB differentiation reveals distinct changes in cells expressing HoxB4 at high or low levels. Expression is shown as mean ± SEM of three independent experiments and presented relative to the gene expression in undifferentiated human embryonic stem cells. Abbreviations: EGFP, enhanced green fluorescent protein; SCL, stem cell leukemia factor.

 
Q-PCR analysis of HoxB4 downstream targets Irx5 (Fig. 5D) and FLASH (Fig. 5E) showed downregulation of both proteins at EB day 14 in H9-HoxB4high cells compared with H9. However, only FLASH was significantly decreased (1.967 ± 0.176 vs. 3.167 ± 0.218; p = .01), whereas Irx5 was more variable in H9 and the H9-GFPcontrol and not significantly different.

Impaired Colony Formation Capacity in hESC with High HoxB4 Levels
To measure the capacity of hESC-derived HSCs to develop into mature blood cells, a standard clonogenic progenitor assay was performed. EB-derived cells from various time points were seeded into methylcellulose medium, and myeloid colonies were counted after 14 days. Formation of hematopoietic colonies from unmodified H9 cells was not detected before day 7 of EB formation and increased toward day 21. On day 7, 1 colony (1.3 ± 0.6) per 5 x 105 plated EB cells was detected; however, the number increased to 23 ± 12 colonies by day 14 and peaked at day 21 with 44 ± 11 colonies (Fig. 6A). At all time points, most of the colonies were of myeloid origin (colony-forming unit-granulocytic, monocytic), but a few scattered erythroid colonies (burst-forming unit-erythroid) were detected, mainly on day 14 (Fig. 6B). The phenotype was confirmed by staining the colonies with May-Grünwald-Giemsa stain, and it showed typical blood cell morphologies (Fig. 6C).


Figure 6
View larger version (46K):
[in this window]
[in a new window]

 
Figure 6. Upregulation of HoxB4 reveals lower blood colony formation capacity of EB-differentiated human embryonic stem cells when grown for 14 days in semisolid methylcellulose media. (A): Total number of hematopoietic colony-forming units formed in methylcellulose from EB-derived HoxB4-modified (H9-HoxB4high and H9-HoxB4low) and unmodified H9 cells. No increased myeloid blood colony formation was observed in HoxB4-modified cell populations in three independent experiments shown as mean ± SEM. (B): Phase-contrast images taken from representative erythroid, myeloid, and mixed blood cell-forming colonies. (C): May-Grünwald-Giemsa staining of myeloid colonies picked from the Methocult medium. Abbreviation: EB, embryoid body.

 
Because of increased levels of CD34+ cells in differentiating H9-HoxB4high cells, an improved myeloid colony formation was expected from HSCs with normal differentiation capacity. However, both HoxB4-modified cell lines showed a lower colony formation rate at days 14 and 21 of EB development compared with unmodified H9 cells (Fig. 6A). This decrease was not statistically significant, but it appeared to be strongest for H9-HoxB4high cells.

hESCs Show Impaired Teratoma Formation Capacity When Expressing High Levels of HoxB4
To analyze effects of HoxB4 expression on germ layer differentiation and pluripotency of modified hESCs in vivo, xenografting of unmodified and modified H9 cells into immunodeficient mice was performed. Unmodified H9 cells (Fig. 7A; four mice), H9-EGFPcontrol cells (Fig. 7B; four mice), and H9-HoxB4low cells (Fig. 7C; two mice) developed solid teratomas containing tissues resembling the three germ layers in all injected mice. In contrast, H9-HoxB4high cells formed only cystic teratomas (Fig. 7D) devoid of normal germ layer formation in all four injected mice.


Figure 7
View larger version (104K):
[in this window]
[in a new window]

 
Figure 7. Undifferentiated human embryonic stem cells show an impaired teratoma formation capacity when expressing high levels of HoxB4 but not at low levels. Four teratomas from each group, except in the H9-HoxB4low group (only two mice), were prepared and showed similar morphologies. Shown are representative slides from the center area of the teratomas. (A–D): Hematoxylin-eosin staining of 5-µm paraffin-embedded slides. Unmodified H9 cells (A), H9-EGFPcontrol cells (B), and H9-HoxB4low cells are showing solid teratoma formation into the three germ layers. However, H9-HoxB4high cells (D) produced only cyst-like structures.

 

    DISCUSSION
 Top
 Footnotes
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Conclusion
 Disclosure of Potential...
 Acknowledgments
 References
 
The transcription factor HoxB4 has drawn considerable attention as a potential gene therapy tool for the amplification of HSCs, both in vitro and in vivo [7, 9, 31]. A similar application of HoxB4 during early hematopoiesis from hESCs might open new avenues for regenerative medicine, allowing efficient differentiation and engraftment of genetically corrected hESC clones for transplantation. However, the prominence of HoxB4 expression levels has not been addressed previously. In this study, we report the effects of two different HoxB4-expressing vectors in hESCs in comparison with endogenous HoxB4 expression in an attempt to study the importance of HoxB4 levels throughout EB differentiation. We demonstrate that HoxB4 induces a potential hematoendothelial phenotype during the 2nd week of differentiation, depending on its specific gene expression levels. Furthermore, we observed that this phenotype did not result in improved blood colony formation capacity when transduced hESCs expressed HoxB4 at a threefold higher level than unmodified hESC-derived hematopoietic precursors. In addition, we found that such high overexpression of HoxB4 led to alterations in teratoma formation capacity in vivo, indicating effects on more developing cell types.

Despite HoxB4 being proposed as a potential gene therapy tool for differentiation of ESCs and improving the hematopoietic potential of ESCs [1418], studies using clinically relevant hESCs are in conflict [17, 18]. Wang et al. [17] retrovirally expressed HoxB4 in a subgroup of hESC-derived hematopoietic cells and reported a better HSC proliferation but low colony formation capacity and no impact on engraftment, whereas Bowles et al. [18] transfected HoxB4 directly into undifferentiated hESCs and observed increased numbers of CD34+ and CD45+ cells during EB differentiation and a strong increase in blood colony formation capacity. Their study provided evidence of normal myeloid differentiation for actively HoxB4-expressing hESC-derived HSCs, which in turn increased the hematopoietic potential of the hESCs. However, the highly variable HSC induction found in that study, ranging from 2% to 12% of CD34+ cells, warrants additional experiments. Interestingly, the best hematopoietic differentiation potential was observed with the lowest-expressing clone [18]. This finding is in line with HoxB4-dose being a decisive factor, as suggested in our present study.

Our study builds upon these previous studies assuming that HoxB4 has a positive effect on human hematopoiesis, but to the best of our knowledge, it is the first to correlate the level of HoxB4 expression to induce human embryonic differentiation in an attempt to explain the above-mentioned variations. Furthermore, expressing HoxB4 directly in undifferentiated hESCs made it possible to analyze its role in early hematopoiesis and other developing cell types. We used lentiviral transduction for the transfer of the HoxB4 gene into hESCs because of the fact that lentiviral vectors have proven to be efficient in the genetic modification of hESCs [23, 32, 33]. To quantify the lentivirally induced expression levels, the K562 cell line was chosen as reference for HoxB4 levels because of its stable expression and its previous use in similar studies [18, 19, 34, 35]. Moreover, endogenous HoxB4 levels in differentiating unmodified hESCs-derived HSCs were used for comparison, but the use of somatic HSCs was intentionally avoided because of their variable overall transcriptional activity in different subtypes [6, 34].

By expressing high or low levels of HoxB4, we anticipated a possible therapeutic window for normal blood cell maturation. This was also suggested by Klump et al. for somatic hematopoietic stem and progenitor cells [36]. Our HoxB4high vector, which induced HoxB4 expression severalfold above endogenous levels, resulted in problems with myeloid differentiation. We also found that the common retroviral MSCV-based control vector induced even higher levels of HoxB4 than our lentiviral vectors, potentially explaining the failure to induce myeloid differentiation from hESCs [17]. The HoxB4low vector was especially constructed to provide a low level HoxB4 expression to avoid any possible interference with myeloid functions. However, our analysis revealed that HoxB4low induction, which was below endogenous HoxB4 expression, was perhaps too low to increase early hematopoietic differentiation.

Our study provides evidence for a lower HoxB4 threshold level during early embryonic hematopoiesis and a potential maximum level during later blood cell maturation, which correlates with concentration-dependent effects of other transcription factors [3739]. Notably, developmental transcription factors, such as HoxB4, may generate effects that are dependent not only on their concentration but also on the stage of differentiation of the target cells. Thus, it is possible that very high expression of HoxB4 at early stages enhanced development of HSCs but also prevented blood cell maturation when the Ubiquitin-C promoter further elevated HoxB4 in these more differentiated cells. Although both vectors produced higher HoxB4 levels in undifferentiated cells, only the HoxB4high vector maintained expression above the endogenous levels in CD34+ cells at later time points of differentiation. As to the variety of differentiating cell types, the Ubiquitin-C promoter was difficult to predict; hence, it was necessary to follow the transcriptional activity over time. This information highlights the importance of expression levels within certain time frames and offers an approach for the evaluation of studies overexpressing transcription factors. However, stable transgene expression might be a suboptimal method of inducing hematopoiesis because of the fact that HoxB4 is not usually expressed in mature blood cell populations [7]. Western blot analysis showed that our stably expressed fusion gene produced two prominent products in HoxB4high hESCs that were not found in the HeLa cell line. The lower band could be generated as a result of alternative translation initiation involving the second in-frame ATG codon within the HoxB4 gene [40, 41]. Alternatively, the shorter isoform could be due to partial degradation often seen from fusion proteins [42, 43]. An accumulation of degradation products after long-term ectopic expression might lead to toxic effects in hESCs. Therefore, we instead suggest that regulatable vectors, such as the well-established tetracycline system [4447], could be a better option for additional studies. However, this system requires adaptation for hESCs and application of effective human promoters rather than the CMV promoter [48, 49]. Also, new nonviral transposon-mediated gene transfer systems may be a safer option [50], also promising high efficiency and inducibility in embryonic stem cells [51, 52]. Generally, HoxB4 regulation could avoid possible side effects caused by expression above the therapeutic level.

Furthermore, it is important to define possible drawbacks of HoxB4 gene modification if hESC-derived HSCs are to be used clinically. We described a potentially excessive expression level of HoxB4 in H9-HoxB4high cells, which limited the myeloid differentiation capacity of hESC-derived HSCs. It might be argued that other cell types instead of myeloid lineages were supported when differentiation was induced from the hESCs. In particular, increased levels of the hematoendothelial marker and cell adhesion molecule VE-cadherin could imply that HoxB4 induced an endothelial phenotype [53], although it is also expressed in primitive hematopoietic cells. Furthermore, increased CD38 expression (localized on the surface of many immune cells including leukocytes, B and natural killer cells) suggests, at least partially, possible lymphoid lineage development of the HoxB4high cells [5456]. The lack of CD45 expression, which was expected on more mature lymphoid cells, might indicate that HoxB4-induced self-renewal caused reduced final maturation of these cells [8, 57].

Besides the above-mentioned support of HoxB4 in differentiation of hematopoietic cell types, we generally observed a decrease of EGFP-HoxB4-modified cells in differentiating EBs, but not with EGFPcontrol cells. This may have been caused by increased sensitivity to apoptosis [58]. However, analysis of the component of the FAS-Capsase8 apoptotic pathway and HoxB4 downstream target FLASH instead rather suggests a decreased apoptosis in our HoxB4high cells [59, 60]. The decreased proliferation caused by HoxB4 overexpression has been shown in adult cell types, such as stromal cells [58] and HSCs [61], but we discovered this effect across a wider range of cells differentiating from hESCs. To test whether this finding was cell line-dependent, we modified another hESC line, HS181, with the HoxB4high construct and observed an even stronger proliferation disadvantage (data not shown). An explanation may be attributable to different HoxB4 targets in the diverse developing cell types, excluding some hematopoietic lineages. Nevertheless, analysis of HoxB4 downstream target Irx5 [62] did not reveal any effect in either HoxB4high or HoxB4low cells, possibly because of the mixed cell populations analyzed. Investigating a panel of HoxB4-related genes such as those recently published in mESCs [13] would potentially provide a more comprehensive answer to why HoxB4-expressing cells disappeared during differentiation. Cell sorting of specific populations could tentatively give clearer results regarding HoxB4 signaling, allowing a well-controlled comparison of parallel differentiating cells. However, in this study we avoided the harsh treatment of EB dissociation and single-cell sorting to obtain unaltered HoxB4 expression levels.

Elaborating upon the effects of HoxB4 on other lineages, except the hematopoietic one, we analyzed whether HoxB4 could induce effects on germ layer development in vivo. Since HoxB4 does not induce direct differentiation of hESCs to HSCs, other cell types that may be affected develop during this process. Unfortunately, cell purification methods are not 100% efficient, and contaminating cell types might cause severe side effects upon transplantation. Our study showed effects on germ layer development and is the first indication of a possible influence of HoxB4 during the complex teratoma formation. Although H9-HoxB4low cells developed normally into tissues representing the three germ layers, the H9-HoxB4high cells formed only cysts. The mechanism for the cystic development of hESC is not known, but our H9 control cells, which were injected under the testis capsule, formed solid teratomas. Given the injected cell dose with ≥60% gene-modified cells, it was surprising that the reciprocal unmodified population was unable to generate solid teratomas. Overexpressed HoxB4 has been reported to cause anterior deletions in Xenopus development, illustrating that it can influence many cell types besides the hematopoietic [63]. Additional studies could address the issue of which cell types can be affected by ectopic HoxB4 in human development. Although we observed no inducible CD34 expression in neighboring cells, future investigations comparing a wider panel of extracellular and intracellular markers could give insight into the large range of HoxB4 signaling effects. The answers may help to decide where and how this transcription factor acts and how it may be used in therapy.


    CONCLUSION
 Top
 Footnotes
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Conclusion
 Disclosure of Potential...
 Acknowledgments
 References
 
In conclusion, our data demonstrate that HoxB4 has differential effects on embryonic hematopoiesis from hESCs in vitro and general differentiation in vivo, depending on expression levels. We suggest that follow-up studies with a titration of HoxB4 levels could be an opportunity to define a therapeutic window of HoxB4 expression for later clinical application of hESC-derived HSCs. Failure to monitor the changes of transgene expression levels during the differentiation and to define such a therapeutic window could potentially hamper future evaluations and use of HoxB4 in therapeutic hematopoiesis.


    DISCLOSURE OF POTENTIAL CONFLICTS OF INTEREST
 Top
 Footnotes
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Conclusion
 Disclosure of Potential...
 Acknowledgments
 References
 
The authors indicate no potential conflicts of interest.


    ACKNOWLEDGMENTS
 Top
 Footnotes
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Conclusion
 Disclosure of Potential...
 Acknowledgments
 References
 
We are grateful to Monika Jansson, Ann Wallblom, and Emma Emanuelsson for fluorescence in situ hybridization analysis; to Magnus Bäckesjö for helping to establish Q-PCR; and to Jessica Cedervall and Karin Gertow for assisting with teratoma analysis. We also thank Rachael Sugars for commenting on the manuscript. This work was supported by the Swedish Medical Research Council/Juvenile Diabetes Research Foundation International. A.A. is currently affiliated with the Department of Hematology and Oncology, Tartu University, Tartu, Estonia, and the Competence Centre for Cancer Research, Tallinn, Estonia.


    FOOTNOTES
 
Author contributions: C.U.: conception and design, collection and/or assembly of data, data analysis and interpretation, manuscript writing, final approval of manuscript; E.K.: collection and/or assembly of data, data analysis and interpretation, manuscript writing, final approval of manuscript; A.T.: data analysis and interpretation, manuscript writing, final approval of manuscript; B.S.: collection and/or assembly of data, data analysis and interpretation, final approval of manuscript; U.F. and H.C.: collection and/or assembly of data, final approval of manuscript; M.W.: financial support, provision of study material or patients, final approval of manuscript; O.H.: financial support, provision of study material or patients, manuscript writing, final approval of manuscript; A.A.: conception and design, administrative support, collection and/or assembly of data, data analysis and interpretation, manuscript writing, final approval of manuscript; L.A.-R.: financial support, administrative support, provision of study material or patients, data analysis and interpretation, manuscript writing, final approval of manuscript; M.S.D.: conception and design, financial support, administrative support, provision of study material or patients, collection and/or assembly of data, data analysis and interpretation, manuscript writing, final approval of manuscript.


    REFERENCES
 Top
 Footnotes
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Conclusion
 Disclosure of Potential...
 Acknowledgments
 References
 

  1. Thomson JA, Itskovitz-Eldor J, Shapiro SS et al. Embryonic stem cell lines derived from human blastocysts. Science 1998;282:1145–1147.[Abstract/Free Full Text]

  2. Reubinoff BE, Pera MF, Fong CY et al. Embryonic stem cell lines from human blastocysts: Somatic differentiation in vitro. Nat Biotechnol 2000;18:399–404.[CrossRef][Medline]

  3. Schuldiner M, Yanuka O, Itskovitz-Eldor J et al. Effects of eight growth factors on the differentiation of cells derived from human embryonic stem cells. Proc Natl Acad Sci U S A 2000;97:11307–11312.[Abstract/Free Full Text]

  4. Bhatia M, Bonnet D, Wu D et al. Bone morphogenetic proteins regulate the developmental program of human hematopoietic stem cells. J Exp Med 1999;189:1139–1148.[Abstract/Free Full Text]

  5. Bhardwaj G, Murdoch B, Wu D et al. Sonic hedgehog induces the proliferation of primitive human hematopoietic cells via BMP regulation. Nat Immunol 2001;2:172–180.[CrossRef][Medline]

  6. Sauvageau G, Lansdorp PM, Eaves CJ et al. Differential expression of homeobox genes in functionally distinct CD34+ subpopulations of human bone marrow cells. Proc Natl Acad Sci U S A 1994;91:12223–12227.[Abstract/Free Full Text]

  7. Sauvageau G, Thorsteinsdottir U, Eaves CJ et al. Overexpression of HOXB4 in hematopoietic cells causes the selective expansion of more primitive populations in vitro and in vivo. Genes Dev 1995;9:1753–1765.[Abstract/Free Full Text]

  8. Antonchuk J, Sauvageau G, Humphries RK. HOXB4-induced expansion of adult hematopoietic stem cells ex vivo. Cell 2002;109:39–45.[CrossRef][Medline]

  9. Antonchuk J, Sauvageau G, Humphries RK. HOXB4 overexpression mediates very rapid stem cell regeneration and competitive hematopoietic repopulation. Exp Hematol 2001;29:1125–1134.[CrossRef][Medline]

  10. Buske C, Feuring-Buske M, Abramovich C et al. Deregulated expression of HOXB4 enhances the primitive growth activity of human hematopoietic cells. Blood 2002;100:862–868.

  11. Amsellem S, Pflumio F, Bardinet D et al. Ex vivo expansion of human hematopoietic stem cells by direct delivery of the HOXB4 homeoprotein. Nat Med 2003;9:1423–1427.[CrossRef][Medline]

  12. Lu SJ, Feng Q, Ivanova Y et al. Recombinant HoxB4 fusion proteins enhance hematopoietic differentiation of human embryonic stem cells. Stem Cells Dev 2007;16:547–559.[CrossRef][Medline]

  13. Schiedlmeier B, Santos AC, Ribeiro A et al. HOXB4's road map to stem cell expansion. Proc Natl Acad Sci U S A 2007;104:16952–16957.[Abstract/Free Full Text]

  14. Helgason CD, Sauvageau G, Lawrence HJ et al. Overexpression of HOXB4 enhances the hematopoietic potential of embryonic stem cells differentiated in vitro. Blood 1996;87:2740–2749.[Abstract/Free Full Text]

  15. Pilat S, Carotta S, Schiedlmeier B et al. HOXB4 enforces equivalent fates of ES-cell-derived and adult hematopoietic cells. Proc Natl Acad Sci U S A 2005;102:12101–12106.[Abstract/Free Full Text]

  16. Kyba M, Perlingeiro RC, Daley GQ. HoxB4 confers definitive lymphoid-myeloid engraftment potential on embryonic stem cell and yolk sac hematopoietic progenitors. Cell 2002;109:29–37.[CrossRef][Medline]

  17. Wang L, Menendez P, Shojaei F et al. Generation of hematopoietic repopulating cells from human embryonic stem cells independent of ectopic HOXB4 expression. J Exp Med 2005;201:1603–1614.[Abstract/Free Full Text]

  18. Bowles KM, Vallier L, Smith JR et al. HOXB4 overexpression promotes hematopoietic development by human embryonic stem cells. STEM CELLS 2006;24:1359–1369.[Abstract/Free Full Text]

  19. Schiedlmeier B, Klump H, Will E et al. High-level ectopic HOXB4 expression confers a profound in vivo competitive growth advantage on human cord blood CD34+ cells, but impairs lymphomyeloid differentiation. Blood 2003;101:1759–1768.

  20. Zhang XB, Schwartz JL, Humphries RK et al. Effects of HOXB4 overexpression on ex vivo expansion and immortalization of hematopoietic cells from different species. STEM CELLS 2007;25:2074–2081.[Abstract/Free Full Text]

  21. Qin XF, An DS, Chen IS et al. Inhibiting HIV-1 infection in human T cells by lentiviral-mediated delivery of small interfering RNA against CCR5. Proc Natl Acad Sci U S A 2003;100:183–188.[Abstract/Free Full Text]

  22. Donnelly ML, Hughes LE, Luke G et al. The ‘cleavage’ activities of foot-and-mouth disease virus 2A site-directed mutants and naturally occurring ‘2A-like’ sequences. J Gen Virol 2001;82:1027–1041.[Abstract/Free Full Text]

  23. Imreh MP, Wolbank S, Unger C et al. Culture and expansion of the human embryonic stem cell line HS181, evaluated in a double-color system. Stem Cells Dev 2004;13:337–343.[CrossRef][Medline]

  24. Hovatta O, Mikkola M, Gertow K et al. A culture system using human foreskin fibroblasts as feeder cells allows production of human embryonic stem cells. Hum Reprod 2003;18:1404–1409.[Abstract/Free Full Text]

  25. Kärner E, Unger C, Sloan AJ et al. Bone matrix formation in osteogenic cultures derived from human embryonic stem cells in vitro. Stem Cells Dev 2007;16:39–52.[CrossRef][Medline]

  26. Tian X, Kaufman DS. Hematopoietic development of human embryonic stem cells in culture. Methods Mol Med 2005;105:425–436.[Medline]

  27. Khoo ML, McQuade LR, Smith MS et al. Growth and differentiation of embryoid bodies derived from human embryonic stem cells: Effect of glucose and basic fibroblast growth factor. Biol Reprod 2005;73:1147–1156.[Abstract/Free Full Text]

  28. Gertow K, Wolbank S, Rozell B et al. Organized development from human embryonic stem cells after injection into immunodeficient mice. Stem Cells Dev 2004;13:421–435.[CrossRef][Medline]

  29. Kustikova OS, Wahlers A, Kuhlcke K et al. Dose finding with retroviral vectors: Correlation of retroviral vector copy numbers in single cells with gene transfer efficiency in a cell population. Blood 2003;102:3934–3937.

  30. Tian X, Morris JK, Linehan JL et al. Cytokine requirements differ for stroma and embryoid body-mediated hematopoiesis from human embryonic stem cells. Exp Hematol 2004;32:1000–1009.[CrossRef][Medline]

  31. Thorsteinsdottir U, Sauvageau G, Humphries RK. Enhanced in vivo regenerative potential of HOXB4-transduced hematopoietic stem cells with regulation of their pool size. Blood 1999;94:2605–2612.

  32. Gropp M, Itsykson P, Singer O et al. Stable genetic modification of human embryonic stem cells by lentiviral vectors. Mol Ther 2003;7:281–287.[CrossRef][Medline]

  33. Ma Y, Ramezani A, Lewis R et al. High-level sustained transgene expression in human embryonic stem cells using lentiviral vectors. STEM CELLS 2003;21:111–117.[Abstract/Free Full Text]

  34. Giampaolo A, Sterpetti P, Bulgarini D et al. Key functional role and lineage-specific expression of selected HOXB genes in purified hematopoietic progenitor differentiation. Blood 1994;84:3637–3647.[Abstract/Free Full Text]

  35. Giannola DM, Shlomchik WD, Jegathesan M et al. Hematopoietic expression of HOXB4 is regulated in normal and leukemic stem cells through transcriptional activation of the HOXB4 promoter by upstream stimulating factor (USF)-1 and USF-2. J Exp Med 2000;192:1479–1490.[Abstract/Free Full Text]

  36. Klump H, Schiedlmeier B, Baum C. Control of Self-Renewal and Differentiation of Hematopoietic Stem Cells: HOXB4 on the Threshold. Ann N Y Acad Sci 2005;1044:6–15.[CrossRef][Medline]

  37. Driever W, Nusslein-Volhard C. The bicoid protein determines position in the Drosophila embryo in a concentration-dependent manner. Cell 1988;54:95–104.[CrossRef][Medline]

  38. Emambokus N, Vegiopoulos A, Harman B et al. Progression through key stages of haemopoiesis is dependent on distinct threshold levels of c-Myb. EMBO J 2003;22:4478–4488.[CrossRef][Medline]

  39. Rosenbauer F, Wagner K, Kutok JL et al. Acute myeloid leukemia induced by graded reduction of a lineage-specific transcription factor, Pu 1 Nat Genet 2004;36:624–630.

  40. Kozak M. Pushing the limits of the scanning mechanism for initiation of translation. Gene 2002;299:1–34.[CrossRef][Medline]

  41. Gu S, Anton A, Salim S et al. Alternative translation initiation of human regulators of G-protein signaling-2 yields a set of functionally distinct proteins. Molecular Pharmacology 2008;73:1–11.[Abstract/Free Full Text]

  42. Dilber MS, Phelan A, Aints A et al. Intercellular delivery of thymidine kinase prodrug activating enzyme by the herpes simplex virus protein, VP22. Gene Ther 1999;6:12–21.[CrossRef][Medline]

  43. Horgan AM, Stork PJ. Examining the mechanism of Erk nuclear translocation using green fluorescent protein. Exp Cell Res 2003;285:208–220.[CrossRef][Medline]

  44. Gossen M, Freundlieb S, Bender G et al. Transcriptional activation by tetracyclines in mammalian cells. Science 1995;268:1766–1769.[Abstract/Free Full Text]

  45. Hofmann A, Nolan GP, Blau HM. Rapid retroviral delivery of tetracycline-inducible genes in a single autoregulatory cassette. Proc Natl Acad Sci U S A 1996;93:5185–5190.[Abstract/Free Full Text]

  46. Kafri T, van Praag H, Gage FH et al. Lentiviral vectors: Regulated gene expression. Mol Ther 2000;1:516–521.[CrossRef][Medline]

  47. Vieyra DS, Goodell MA. Pluripotentiality and conditional transgene regulation in human embryonic stem cells expressing insulated tetracycline-ON transactivator. STEM CELLS 2007;25:2559–2566.[Abstract/Free Full Text]

  48. Suter DM, Cartier L, Bettiol E et al. Rapid generation of stable transgenic embryonic stem cell lines using modular lentivectors. STEM CELLS 2006;24:615–623.[Abstract/Free Full Text]

  49. Liew CG, Draper JS, Walsh J et al. Transient and stable transgene expression in human embryonic stem cells. STEM CELLS 2007;25:1521–1528.[Abstract/Free Full Text]

  50. Zhang XB, Beard BC, Trobridge GD et al. High incidence of leukemia in large animals after stem cell gene therapy with a HOXB4-expressing retroviral vector. J Clin Invest 2008;118:1502–1510.[CrossRef][Medline]

  51. Wilber A, Linehan JL, Tian X et al. Efficient and stable transgene expression in human embryonic stem cells using transposon-mediated gene transfer. STEM CELLS 2007;25:2919–2927.[Abstract/Free Full Text]

  52. Cadiñanos J, Bradley A. Generation of an inducible and optimized piggyBac transposon system. Nucleic Acids Res 2007;35:e87.[Abstract/Free Full Text]

  53. Wang L, Li L, Shojaei F et al. Endothelial and hematopoietic cell fate of human embryonic stem cells originates from primitive endothelium with hemangioblastic properties. Immunity 2004;21:31–41.[CrossRef][Medline]

  54. Haddad R, Caignard A, Visentin G et al. The HOXB4 homeoprotein improves ex vivo generation of functional human NK-cell progenitors. Leukemia 2007;21:1836–1839.[CrossRef][Medline]

  55. Chan KM, Bonde S, Klump H et al. Hematopoiesis and immunity of HOXB4-transduced embryonic stem cell-derived hematopoietic progenitor cells. Blood 2008;111:2953–2961.

  56. Haddad R, Pflumio F, Vigon I et al. The HOXB4 homeoprotein differentially promotes ex vivo expansion of early human lymphoid progenitors. STEM CELLS 2008;26:312–322.[Abstract/Free Full Text]

  57. Milsom MD, Duxbury R, Gagen D et al. Overexpression of HOXB4 confers a myelo-erythroid differentiation delay in vitro. Leukemia 2005;19:148–153.[Medline]

  58. Will E, Speidel D, Wang Z et al. HOXB4 inhibits cell growth in a dose-dependent manner and sensitizes cells towards extrinsic cues. Cell Cycle 2006;5:14–22.[Medline]

  59. Morgan R, Nalliah A, Morsi El-Kadi AS. FLASH, a component of the FAS-CAPSASE8 apoptotic pathway, is directly regulated by Hoxb4 in the notochord. Dev Biol 2004;265:105–112.[CrossRef][Medline]

  60. Morgan R, Pettengell R, Sohal J. The double life of HOXB4. FEBS Lett 2004;578:1–4.[CrossRef][Medline]

  61. Brun AC, Fan X, Bjornsson JM et al. Enforced adenoviral vector-mediated expression of HOXB4 in human umbilical cord blood CD34+ cells promotes myeloid differentiation but not proliferation. Mol Ther 2003;8:618–628.[CrossRef][Medline]

  62. Theokli C, Morsi El-Kadi AS, Morgan R. TALE class homeodomain gene Irx5 is an immediate downstream target for Hoxb4 transcriptional regulation. Dev Dyn 2003;227:48–55.[CrossRef][Medline]

  63. Hooiveld MH, Morgan R, in der Rieden P et al. Novel interactions between vertebrate Hox genes. Int J Dev Biol 1999;43:665–674.[Medline]





This Article
Free via Open Access: OA
Right arrow OA Abstract
Right arrow Full Text (PDF)
Right arrowOA All Versions of this Article:
2007-0876v1
26/10/2455    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Unger, C.
Right arrow Articles by Dilber, M. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Unger, C.
Right arrow Articles by Dilber, M. S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
STEM CELLS THE ONCOLOGIST CME ALPHAMED PRESS JOURNALS