Stem Cells
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


First published online November 29, 2007
Stem Cells Vol. 26 No. 2 February 2008, pp. 455 -464
doi:10.1634/stemcells.2007-0628; www.StemCells.com
© 2008 AlphaMed Press

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
2007-0628v1
26/2/455    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Saretzki, G.
Right arrow Articles by Lako, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Saretzki, G.
Right arrow Articles by Lako, M.

EMBRYONIC STEM CELLS

Downregulation of Multiple Stress Defense Mechanisms During Differentiation of Human Embryonic Stem Cells

Gabriele Saretzkia,b, Theresia Walterc,d, Stuart Atkinsonc,d, Jõao F. Passosb, Bettina Barethb, W. Nicol Keithe, Rebecca Stewartc,d, Stacey Hoaree, Miodrag Stojkovicc,d, Lyle Armstrongc,d, Thomas von Zglinickib, Majlinda Lakoc,d

aCrucible Lab, Institute for Ageing and Health, International Centre for Life, and
bHenry Wellcome Building for Biogerontology Research, Institute for Ageing and Health, Newcastle University, Newcastle upon Tyne, United Kingdom;
cNorth East Institute for Stem Cell Research and
dInstitute of Human Genetics, International Centre for Life, Newcastle University, Newcastle upon Tyne, United Kingdom;
eCentre for Oncology and Applied Pharmacology, Cancer Research UK Beatson Laboratories, University of Glasgow, Glasgow, United Kingdom

Key Words. Stem cells • Reactive oxygen species • Antioxidant • Telomere • Telomerase • Mitochondria • DNA damage Disposable soma

Correspondence: Correspondence: Gabriele Saretzki, Ph.D., Crucible Lab, Institute of Human Genetics, Central Parkway, Newcastle upon Tyne NE1 3BZ, United Kingdom. Telephone: 44-241-8813; Fax: 44-241-8810; e-mail: gabriele.saretzki{at}ncl.ac.uk

Received on August 3, 2007; accepted for publication on November 19, 2007.

First published online in STEM CELLS EXPRESS  November 29, 2007.

    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Conclusion
 Disclosure of Potential...
 Acknowledgments
 References
 
Evolutionary theory predicts that cellular maintenance, stress defense, and DNA repair mechanisms should be most active in germ line cells, including embryonic stem cells that can differentiate into germ line cells, whereas it would be energetically unfavorable to keep these up in mortal somatic cells. We tested this hypothesis by examining telomere maintenance, oxidative stress generation, and genes involved in antioxidant defense and DNA repair during spontaneous differentiation of two human embryonic stem cell lines. Telomerase activity was quickly downregulated during differentiation, probably due to deacetylation of histones H3 and H4 at the hTERT promoter and deacetylation of histone H3 at hTR promoter. Telomere length decreased accordingly. Mitochondrial superoxide production and cellular levels of reactive oxygen species increased as result of increased mitochondrial biogenesis. The expression of major antioxidant genes was downregulated despite this increased oxidative stress. DNA damage levels increased during differentiation, whereas expression of genes involved in different types of DNA repair decreased. These results confirm earlier data obtained during mouse embryonic stem cell differentiation and are in accordance with evolutionary predictions.

Disclosure of potential conflicts of interest is found at the end of this article.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Conclusion
 Disclosure of Potential...
 Acknowledgments
 References
 
Embryonic stem cells (ESC) have the capacity to differentiate almost into any cell type in the adult organism, including germ line cells (reviewed in [1]). As such, they are not part of the "disposable soma" [2]. Theory requires that they must be endowed with superior maintenance and repair systems to ensure sufficient genomic stability over multiple generations, whereas this would not be necessary for differentiated cells. It was proposed early on that ageing may be the result of an energy-saving switching off of these maintenance mechanisms at or around the time of differentiation of somatic cells from the germ line [2]. Indeed, it has been shown that ESC prepared from murine blastocysts show a 100-fold lower mutation frequency compared with embryonic fibroblasts prepared from the same strain [3]. There are two principal mechanisms to explain how ESC can achieve a lower mutational load (reviewed in [4]). First, spontaneous mutation frequencies in ESC must be suppressed by low levels of stress generation, high activities of stress defense, and high activity and fidelity of repair mechanisms. Second, ESC that accumulate mutations or DNA damage must be eliminated from the stem cell population either by induction of differentiation or by facilitated cell death. There is evidence to suggest that this is mediated by lack of a G1 checkpoint in ESC, thereby allowing mutated cells to progress into S-phase, where the DNA damage is amplified, eventually resulting in cell death [5].

Under physiological conditions, reactive oxygen species (ROS) generated as by-product of mitochondrial respiration are a major source of DNA damage. Accordingly, we could show that murine ESC (mESC) are highly proficient in antioxidant defense, a capacity that is progressively diminished during differentiation [6]. Transcriptomic [6] and proteomic [7] analyses showed that ESC express higher levels of antioxidant enzymes than differentiated cells. Low levels of ROS are necessary for the maintenance of the capacity for self-renewal in human and murine somatic stem cells, whereas increased ROS levels initiate differentiation via activation of p38 mitogen-activated protein kinase [810]. Moreover, mESC can perform more efficient DNA single-strand break repair than their somatic counterparts [6]. Both antioxidant defense and DNA repair in mESC were strongly associated with high telomerase activity [11].

There are indications that stem cells maintain low levels of ROS not only by high antioxidant activity but also by reduced oxygen consumption and low mitochondrial biogenesis. There are low numbers of mitochondria in liver and hematopoietic stem cells, which also show low oxygen consumption [12, 13]. Human ESC (hESC) also contain very few mitochondria [14]. During the differentiation process, mitochondrial proliferation and transcription increases significantly, which suggests that mitochondrial activity might play an important role in the balance between self-renewal and differentiation in ESC [15].

Taken together, these data suggest that ESC are most likely to rely on antioxidant stress defense mechanisms to reduce the cause of mutations as well as efficient apoptosis to eliminate them from the parent population. In this study, we investigated the role of antioxidant stress defense, DNA repair, and mitochondrial biogenesis in hESC and during their differentiation. We found that hESC maintain high levels of telomerase activity, which protects from telomere shortening and erosion, and that this is significantly downregulated upon their differentiation. In parallel, increased levels of ROS and DNA damage were found in the hESC-derived differentiated cells, suggesting that they are less proficient in protecting their genome in comparison with the ESC themselves. These data have profound consequences for future stem cell-based therapies that are heavily dependent on the quality of the differentiated cells and their ability to maintain an intact genome.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Conclusion
 Disclosure of Potential...
 Acknowledgments
 References
 
Culture and Differentiation of hESC
Two hESC lines were used: H1 (obtained from Wisconsin Alumni Research Foundation) and hES-NCL1 [16]. Human ESC were grown on mitotically inactivated mouse embryonic fibroblasts (MEF) with hESC medium containing Knockout Dulbecco's modified Eagle's medium (DMEM) (Invitrogen, Paisley, U.K., http://www.invitrogen.com), 100 µM β-mercaptoethanol (Sigma-Aldrich, Gillingham, U.K., http://www.sigmaaldrich.com), 1 mM L-glutamine (Invitrogen), 100 mM nonessential amino acids (Invitrogen), 20% serum replacement (Invitrogen), 1% penicillin-streptomycin (Sigma-Aldrich), and 8 ng/ml fibroblast growth factor 2 (FGF2; Invitrogen). hESC medium was changed daily, and the cells were passaged by incubation in 1 mg/ml collagenase IV (Invitrogen) for 5–8 minutes at 37°C or mechanically dissociated and then removed to freshly prepared MEF. Differentiation of hESC was induced by harvesting hESC with collagenase as described above and culturing them in gelatin-coated plates in Knockout DMEM (Invitrogen) containing 20% fetal calf serum (FCS; HyClone, Logan, UT, http://www.hyclone.com), 1 mM L-glutamine (Invitrogen), 100 mM nonessential amino acids (Invitrogen), and 1% penicillin-streptomycin (Sigma-Aldrich). MRC-5 and its derivative MRC/hTERT were grown in DMEM with 10% FCS (Sigma-Aldrich), 1% glutamine, and penicillin/streptomycin (Sigma-Aldrich).

Flow Cytometry Analysis of hESC
For the flow cytometry analysis, the hESC were collected using collagenase IV treatment (1 mg/ml for 5 minutes) followed by brief Accutase incubation (Chemicon, Temecula, CA, http://www.chemicon.com). Human ESC were suspended in staining buffer (phosphate-buffered saline [PBS] + 5% FCS) at a concentration of 106 cells per milliliter, and 105 cells were stained with TRA-1–60 (final concentration, 10 µg/ml; Chemicon). Several washes were carried out in staining buffer before proceeding to staining with secondary antibodies (goat anti-mouse IgM conjugated to fluorescein isothiocyanate; final concentration, 6 µg/ml). Cells were washed again three times and resuspended in staining buffer before being analyzed with a FACSCalibur (BD Biosciences, San Diego, http://www.bdbiosciences.com) using the CellQuest software. Ten thousand events were acquired for each sample, and propidium iodide staining (1 µg/ml) was used to distinguish live from dead cells for extracellular markers.

Reverse Transcription-Polymerase Chain Reaction Analysis
The reverse transcription was carried out using the cDNA II kit (Ambion, Huntingdon, U.K., http://www.ambion.com) according to the manufacturer's instructions. In brief, hESC were submerged in 100 µl of ice-cold cell lysis buffer and lysed by incubation at 75°C for 10 minutes. Genomic DNA was degraded by incubation with DNase I for 15 minutes at 37°C. RNA was reverse-transcribed using Moloney murine leukemia virus reverse transcriptase and random hexamers following the manufacturer's instructions.

LightCycler Real-Time Polymerase Chain Reaction Analysis
Real-time polymerase chain reaction (PCR) analysis was carried out using QuantiTect SYBR Green PCR Master mix (Qiagen, Crawley, U.K., http://www1.qiagen.com). The reaction was performed with 1 µl of cDNA per 20-µl reaction, and each reaction was performed in triplicate. The LightCycler experimental run protocol used was as follows: PCR activation step (95°C for 15 minutes), amplification with data acquisition repeated 50 times (94°C for 15 seconds, annealing temperature for primers for 30 seconds, 72°C for 20 seconds with a single fluorescence data collection), melting curve (60°C–95°C with a temperature transition rate of 0.1°C/second and continuous fluorescence data collection), and finally cooling to 40°C. The crossing point (CP) for each transcript was determined using second derivative maximum method in the LightCycler software, version 3.5.3 (Roche Diagnostics, Basel, Switzerland, http://www.roche-applied-science.com). GAPDH CP for each sample was used as the internal control of these real-time analyses, as prior microarray analysis showed constant expression of this gene between ESC and differentiated cells [17]. The data were analyzed using the LightCycler relative quantification software, version 1.01 (Roche Diagnostics). For each gene, the value for the positive control was set to 1 (100%), and all other values were calculated with respect to this. Statistical significance of the results was assessed using Student's t test (p < .05). PCRs were carried out using the primers shown in supplemental online Table 1.

Telomeric Repeat Amplification Protocol Assay
The Telo TAGGG Telomerase PCR ELISA Plus (Roche Diagnostics) was used to measure telomerase activity. H1 and hES-NCL1 lines were cultured and differentiated for 4, 8, 12, 16, and 20 days as described above. To prepare lysates of undifferentiated cells, hESC were detached with collagenase IV (1 mg/ml), collected in a 1.5-ml tube (Eppendorf AG, Hamburg, Germany, http://www.eppendorf.com) with hESC media, spun down at 50g for 3 minutes, and washed with PBS. Afterward, the cells were resuspended in lysis buffer (contained in kit), and lysates were prepared as described in the manufacturer's instructions. To prepare lysates of differentiated cells, one well of a six-well plate was used. The cells were detached using trypsin, and the cell pellet was resuspended in 100 µl of lysis buffer or frozen at –80°C until preparation of lysates. The cell pellets were incubated on ice for 30 minutes and spun at 16,000g for 20 minutes at 4°C. The supernatant was carefully removed to get rid of any cellular debris. Lysates were then frozen in liquid nitrogen and stored at –80°C until use. Before carrying out the telomeric repeat amplification protocol (TRAP) assay, the protein concentration was determined using Protein Assay (Bio-Rad, Hercules, CA, http://www.bio-rad.com) on a photospectrometer (Genova life science analyzer; Jenway, Felsted, U.K., http://www.jenway.com). Twenty nanograms of protein from each sample was used in the PCR. Lysis buffer was used as negative control. TRAP products were quantified by a colorimetric reaction according to the manufacturer's instructions.

Quantification of TR and TERT by Real-time Reverse Transcription-PCR
The expression of TR and TERT was quantified using the LightCycler Telo TAGGG hTR/hTERT quantification kit (Roche Diagnostics) following the manufacturer's instructions. The LightCycler Telo TAGGG hTERT quantification kit contains primer specific to the unspliced variant of TERT. For quantification of TR, 100 ng of RNA that had been treated with DNase and precipitated was used. For TERT quantification, 200 ng of RNA was used. A standard curve for TR and TERT was done, and the ratios between TR or TERT and the expression of the housekeeping gene PBGD were calculated. The assays were carried out in duplicate for two independent differentiations experiments for hES-NCL1 and H1.

Chromatin Immunoprecipitation Studies
Chromatin immunoprecipitation (ChIP) assays were carried out mainly as described by Atkinson et al. [18] using the three embryonic stem cell lines hES-NCL1, H1, and H9 (obtained from Wisconsin Alumni Research Foundation). In brief, cells were harvested at 70%–80% confluence, and ChIP was done according to the manufacturer's instructions (Upstate, Dundee, U.K., http://www.upstate.com). Sonication was optimized to give chromatin fragments of 500–1,000 base pairs in length, and DNA from each immunoprecipitation was purified using the Qiaquick DNA Purification kit (Qiagen). Also included in the experiment was a no-antibody control immunoprecipitate to detect any background, which, if it was present, was subtracted from each immunoprecipitate within that experiment. Standard errors were generated for quantitative-PCRs by reading each sample in triplicate. The sequences of the primers used for this purpose were as follows: CHIP-TR: forward (fw), ctaaccctaactgagaagggcgta; reverse (rev), ggcgaacgggccagcagctgacatt; CHIP-TERT: fw, tccccttcagtccggcatt; rev, agcggagagaggtcgaatcg.

Staining for {gamma}-H2A.X
Cells grown on coverslips were incubated in 1 ml of 2% paraformaldehyde in PBS for 10 minutes at room temperature. Paraformaldehyde was removed, and cells were washed twice with PBS. Cell permeabilization was carried out by incubation for 45 minutes at room temperature with 1 ml of PBG-Triton. Primary antibody against phosphorylated {gamma}-H2A.X mouse monoclonal anti-phospho-histone H2A.X (Ser 139; Upstate) was added, and cells were incubated for 1 hour at room temperature with gentle agitation. Cells were washed twice with PBG-Triton (Sigma-Aldrich), further incubated for 45 minutes to 1 hour with fluorescein-conjugated secondary antibody (Alexa Fluor 594), and then washed three times with PBS for 5 minutes. Cells were stained for 10 minutes with 400 µl of 4,6-diamidino-2-phenylindole (DAPI). After DAPI staining, the washing step was repeated before mounting cells on slides using an antifade mounting medium (Vectashield; Vector Laboratories, Burlingame, CA, http://www.vectorlabs.com). Slides were examined using a Zeiss confocal microscope (Carl Zeiss, Jena, Germany, http://www.zeiss.com). Quantification was performed by counting {gamma}-H2A.X-positive foci in 150–200 nuclei per experiment.

ROS Levels, Mitochondrial Membrane Potential, and Mitochondrial Mass
To measure mitochondrial superoxide levels, cells were incubated with 5 µM MitoSOX (Molecular Probes, Eugene, OR, http://probes.invitrogen.com) for 10 minutes at 37°C, and FL3 median staining intensity was measured by flow cytometry (Partec, Münster, Germany, http://www.partec.com). Cellular peroxide levels were assessed by staining with 30 µM dihydrorhodamine 123 (DHR) (Molecular Probes) and 80 µM 2',7'-dichlorofluorescin diacetate (DCF-DA; Sigma-Aldrich) for 30 minutes at 37°C and analyzed using FL3 fluorescence. Mitochondrial membrane potential (MMP) was measured as the FL3/FL1 ratio after staining cells with 1 µg/ml JC-1 (5,5',6,6'-tetrachloro-1,1',3,3'-tetraethylbenzimidazolylcarbocyanine iodide; Molecular Probes) in phenol-free RPMI 1640 (Sigma-Aldrich) for 30 minutes at 37°C. Mitochondrial mass was measured as FL1 fluorescence after staining of cells with 10 µM of nonyl acridine orange (NAO; Molecular Probes) for 10 minutes at 37° C in the dark. Cells were analyzed within 1 hour in a flow cytometer (Partec) using blue excitation and the green (FL1) and red (FL3) emission channels System alignment and gain settings were adjusted using fluorescent beads. Cells were gated in forward scatter/side scatter, and the median of the gated fluorescence peak was used as an estimate of the peroxide concentration.

Telomere Fluorescence In Situ Hybridization on Metaphase Spreads
Cells were grown on "slide flasks," and metaphases were generated by treatment of growing cells with 80 µl of colcemid (10 µg/ml) (Sigma-Aldrich) for 2 hours at 37°C followed by treatment with 60 mM KCl for 15 minutes at room temperature and ethanol:acetic acid (3:1) fixation. Air-dried slides were denatured at 85°C and hybridized with 20 µl of a Cy-3 labeled telomeric peptide nucleic acid probe (4 ng/µl) (DakoCytomation, Glostrup, Denmark, http://www.dakocytomation.com) for 2 hours at room temperature in the dark. Cells were washed with 2x sodium chloride, sodium citrate/0.5% Tween for 10 minutes followed by DAPI staining, mounting, and imaging. Imaging was conducted with Zeiss epifluorescence or a LSM510 Meta confocal microscope. For quantification of telomere signals from 20 metaphases per condition, TelomereQuant, version 1.0 (Dako, Glostrup, Denmark, http://www.dako.com), was used.

Statistics
Pairwise Student's t test was used for testing of significances for data presented in Figures 2A, 2B, and 3. The level of significance was p ≤ .05.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Conclusion
 Disclosure of Potential...
 Acknowledgments
 References
 
hESC Differentiation
Spontaneous differentiation of hESC was induced by plating small clumps of cells into gelatin-coated tissue culture plates in differentiation medium containing 20% FCS. hESC are characterized by a high ratio of nucleus to cytoplasm. During differentiation, the cells flattened, lost hESC morphology (data not shown), and differentiated into several cell types. Differentiation was confirmed at the molecular level by downregulation of three hESC markers, SOX2, OCT4, and NANOG (Fig. 1A–1C), as well as loss of the cell surface marker TRA-1–60 (Fig. 1D), by flow cytometry analysis. Differentiation to various extraembryonic and embryonic lineages was confirmed by upregulation of GATA6, GATA4, and IHH (primitive endoderm); CDX2 (trophoectoderm); BRACHYURY (mesoderm); and FGF5 (primitive ectoderm; Fig. 2).


Figure 1
View larger version (24K):
[in this window]
[in a new window]

 
Figure 1. Loss of human embryonic stem cell (hESC) pluripotency during the 20-day differentiation. (A–C): Downregulation of hESC markers SOX2 (A), OCT4 (B), and NANOG (C) during differentiation using real-time reverse transcription-polymerase chain reaction using cDNAs of undifferentiated H1 and hES-NCL1 and differentiated samples collected every 4 days until day 20. Data represent mean ± SEM from three experiments. The value for hESC was set to 1, and all other values were calculated respectively. *, statistically significant changes (p ≤ .05) in expression between each differentiated sample and undifferentiated hESC group. (D): Flow cytometry analysis for TRA-1–60 expression during differentiation. Undifferentiated hESC (light blue) and cells collected at 7 (pink), 14 (yellow), and 21 (dark blue) days were analyzed for TRA-1–60 expression. After 7, 14, and 20 days of differentiation, 6.05%, 2.11%, and 0.5% of the cells, respectively, remained TRA-1–60-positive. Abbreviations: GAPDH, glyceraldehyde-3-phosphate dehydrogenase; hES, human embryonic stem.

 


Figure 2
View larger version (25K):
[in this window]
[in a new window]

 
Figure 2. Changes in gene expression of H1 and hES-NCL1 during 21 days of differentiation. Endodermal (GATA6, GATA4, IHH), trophectodermal (CDX2), mesodermal (BRACHYURY), and primitive ectodermal (FGF5) differentiation marker were used to demonstrate differentiation of monolayers into various lineages. Abbreviations: FGF, fibroblast growth factor; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; hES, human embryonic stem.

 
Diminished Telomere Maintenance During hESC Differentiation
Telomerase activity in hESC is high enough to maintain telomere length indefinitely. Telomerase is downregulated during mESC differentiation [19, 20], whereas overexpression of mTERT, the reverse transcriptase subunit of telomerase, not only conferred a growth advantage to mESC and their differentiated progeny but also reduced their ROS levels [11]. In addition to its role in telomere maintenance, telomerase has been shown to act as a "survival enzyme" in a variety of cell systems [2123]. On this basis, we set out to investigate the regulation of telomerase activity during differentiation of hESC. Real-time reverse transcription (RT)-PCR analysis indicated that the expression of both TERT and TR, the telomerase template RNA subunit, decreased significantly during hESC differentiation (Fig. 3A, 3B), and as expected, this caused a significant downregulation of telomerase activity (Fig. 3C). All expression changes in differentiated samples differed significantly (p ≤ .05) from the values of the hESC except the 4-day time point for TERT (Fig. 3A).


Figure 3
View larger version (24K):
[in this window]
[in a new window]

 
Figure 3. Downregulation of telomerase activity during hESC differentiation. Decrease of TR (A) and TERT (B) RNA during differentiation analyzed by real-time reverse transcription-polymerase chain reaction. (C): Decrease of telomerase activity by telomeric repeat amplification protocol assay. (D, E): Changes in histone H3 and H4 acetylation at the telomerase promoters during differentiation. (D): TERT promoter. (E): TR promoter. Data represent mean ± SEM from three different cell lines (hES-NCL1, H1, and H9). The value for the ESC was set to 100%, and the value for the differentiated cells was calculated with respect to that. Abbreviation: AcH, acetylated histone; hES, human embryonic stem.

 
Chromatin structure is a major determinant of gene expression that plays a particularly important role in maintenance of the pluripotent state of ESC [24]. Moreover, histone modifications that influence chromatin structure have been shown to regulate TERT and TR expression. Specifically, it was found that hypoacetylation of histones H3 (lysines 9 and 14) and H4 (lysines 5, 8, 12, and 16) was associated with lack of TERT expression in telomerase-negative ALT cell lines [18], whereas general inhibition of deacetylation resulted in the desilencing of TERT in human fibroblasts [25]. We used ChIP assays to quantify the amount of H3 and H4 acetylation at the TERT and TR promoters and therefore their accessibility for transcription (Fig. 3D, 3E). For the TERT promoter, we observed that there was a fast and significant downregulation of acetylation of H3 and H4 after 6 days of differentiation and that downregulation persisted during further differentiation (16 days). This decrease in acetylation of the TERT promoter correlated with downregulation of TERT and telomerase activity, suggesting that hypoacetylation of histones on this promoter provides a mechanism for downregulation of telomerase activity during hESC differentiation. The TR promoter, however, showed a rather slow and much more gradual downregulation of acetylation of H3. Moreover, the acetylation of H4 at this promoter seemed to increase at day 6 before being downregulated again at day 16 (Fig. 3E), thus suggesting that acetylation of H4 is perhaps not the determining mechanism for downregulation of TR during the differentiation process.

In accordance with the decrease of telomerase activity, telomeres are gradually lost during differentiation of both ESC lines (Fig. 4A, 4B). Although we could not detect significant telomere shortening until day 4 after onset of differentiation (data not shown), telomere loss was significant at day 7, and the hybridization signal decreased to half of that in stem cells after 2 weeks of differentiation (Fig. 4A, 4B).


Figure 4
View larger version (44K):
[in this window]
[in a new window]

 
Figure 4. Telomere shortening during differentiation by telomere fluorescence in situ hybridization. Metaphases from H1 (A) and hES-NCL1 (B) stem cells and their differentiated progeny were hybridized with telomere probes. Signal intensity was analyzed from 20 metaphases per time point. Representative images (upper rows) and distribution diagrams (lower rows) are shown. Abbreviations: A.U., arbitrary units; ESC, embryonic stem cell; hES, human embryonic stem.

 
Increased ROS Levels and Decreased Expression of Stress Defense Genes During hESC Differentiation
We used three different fluorescent dyes to quantify changes in cellular ROS levels during hESC differentiation. 2',7'-Dichlorodihydrofluorescin diacetate (DCF) is a relatively unspecific probe for oxidative stress that also reacts with nitric oxide to produce fluorescent 2',7'-dichlorofluorescin. DHR is oxidized by peroxides and peroxynitrite to fluorescent rhodamine 123. MitoSOX is targeted toward mitochondria and reacts preferentially with superoxide in the mitochondrial matrix. All three probes detected an increase of ROS levels during differentiation of both embryonic stem cell lines used. Generally, this increase became significant around the 2nd week of differentiation. After 3 weeks, DCF and MitoSOX fluorescence levels were as high as in an established human fetal lung diploid fibroblast strain (MRC-5) at around 50% of its replicative lifespan and above values found in hTERT-immortalized MRC-5 fibroblasts (Fig. 5A, 5C), whereas DHR fluorescence in differentiated progeny of hESC increased only to values similar to those in hTERT-overexpressing MRC-5 fibroblasts (Fig. 5B). Mitochondrial mass, measured by NAO fluorescence, increased continuously over the differentiation period as well and reached 250%–300% of that observed in the undifferentiated stem cells, but it was still lower than that of middle-aged MRC-5 fibroblasts (between population doubling 25 and 35) (Fig. 5D). There was no significant change in mitochondrial membrane potential over the time of differentiation as measured by JC-1 fluorescence (Fig. 5E). Accordingly, expression levels for UCP-2, the major uncoupling protein in human fibroblast-like cells, did not increase during differentiation (data not shown).


Figure 5
View larger version (27K):
[in this window]
[in a new window]

 
Figure 5. ROS measurements and expression analysis of antioxidant genes. Intracellular peroxide levels were analyzed using DCF staining (A) and DHR staining (B). (C): Analysis of mitochondrial superoxide production using MitoSOX. All data are from seven independent experiments and represent mean and SEM. (D): Mitochondrial mass was determined using NAO. (E): Mitochondrial membrane potential was measured using JC1 probe. The data for (D) and (E) are from three independent experiments and represent mean and SEM. MRC-5 and hTERT-immortalized MRC-5 were used as comparisons. (F): Expression changes for antioxidant genes with time (slopes of regression). Abbreviations: A.U., arbitrary units; DCF, 2',7'-dichlorofluorescin; DHR, dihydrorhodamine 123; GSR, glutathione reductase; hESC, human embryonic stem cells; NAO, nonyl acridine orange; rel., relative.

 
Measuring the expression of a number of antioxidant and stress defense genes by quantitative RT-PCR, we found that major antioxidant genes, most notably SOD2 and GPX2, were significantly downregulated during differentiation in both cell lines (Fig. 5F; supplemental online Fig. 1). In general, this downregulation paralleled the increase in ROS (supplemental online Fig. 1) but lagged behind the downregulation of telomerase during differentiation (compare Fig. 3A–3C). In fact, expression levels increased during differentiation for only one gene involved in antioxidant defense (i.e., TXNIP). TXNIP, however, is an inhibitor of the antioxidant enzyme thioredoxin. Regarding chaperones, the expression of HSPA1B decreased significantly during differentiation, whereas HSPB1 did not show any significant tendency (Fig. 5F).

Increased DNA Damage Response and Decreased Expression of Genes Involved in Maintenance of Genome Integrity During Differentiation
Short, uncapped telomeres, as well as DNA double-strand breaks, which can be generated as result of oxidative damage, induce a DNA damage response, characterized by the formation of DNA damage foci containing phosphorylated histone H2A.X ({gamma}-H2A.X) and leading to activation of p53 and its downstream mediators [26, 27]. Persistent activation of the DNA damage response is a hallmark of cellular senescence [28]. In hESC, we observed low frequencies of nuclei containing {gamma}-H2A.X foci (6.9% in H1 and 10.2% in hES-NCL1), which were probably caused by replication stress, indicating that numbers of hESC in a senescence-like state would be very low. However, the frequency of {gamma}-H2A.X-positive cells increased dramatically to 54.3% in H1 and 43.3% in hES-NCL1 after 3 weeks of differentiation (Fig. 6A, 6B). Interestingly, activation of checkpoint function was not accompanied by increased expression of checkpoint kinases (CHEK 1 and 2) or the tumor suppressor TP53 at the mRNA level (data not shown), in line with data showing that activation of checkpoint function in senescence is almost exclusively by phosphorylation [29].


Figure 6
View larger version (26K):
[in this window]
[in a new window]

 
Figure 6. DNA damage response and repair. (A): representative images showing H2A.X staining (red signals) Magnification, x40. (B): {gamma}-H2A.X-stained nuclei were analyzed per time point using confocal microscopy. (C): Expression changes for genes involved in DNA repair with time (slopes of regression). Abbreviation: hES, human embryonic stem; rel., relative.

 
These results, together with earlier data showing downregulation of DNA strand break repair activity and repair gene expression levels during differentiation of mESC [6], prompted us to analyze expression levels of DNA repair genes during hESC differentiation. We found a significant decrease of mRNA levels for all the genes analyzed in both cell lines (Fig. 6C; supplemental online Fig. 2). These genes represent different repair mechanisms, such as mismatch repair (MSH3 and MSH6), double-strand repair (BRCA1), and homologous recombination (DMC1 and PolQ), suggesting a general decrease of DNA repair capability with differentiation. The majority of these changes occurred later in the differentiation process than telomerase downregulation (supplemental online Fig. 2).


    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Conclusion
 Disclosure of Potential...
 Acknowledgments
 References
 
This study brings together three seemingly separate processes that accompany the differentiation of hESC. In two unrelated hESC lines, we found very similar molecular events governing the downregulation of telomerase, the increase of oxidative stress, and the decrease of DNA repair activity during spontaneous differentiation.

We have shown previously that mESC are highly proficient in antioxidant defense and perform an efficient DNA strand break repair, whereas both these abilities decrease markedly during differentiation [6]. In this study, we sought to characterize the oxidative stress resistance and DNA strand break repair in parallel to the regulation of telomerase activity and telomere length during differentiation of hESC. For this purpose, we used the model of hESC spontaneous differentiation in a monolayer upon removal of feeder layers and FGF2, which are known to maintain hESC pluripotency (reviewed in [1, 30]). Loss of pluripotency was confirmed by marked and significant downregulation of NANOG, OCT4, and SOX2 expression, as well as TRA-1–60. Our data suggest deacetylation of histones H3 and H4 in the promoter region of hTERT and deacetylation of histone H3 at the hTR promoter as a candidate mechanism to explain the downregulation of expression of both genes and the loss of telomerase activity during differentiation. Histone modification has been shown before to be an important means to regulate telomerase gene expression [18, 25, 31, 32]. Loss of telomerase activity is essentially complete within 1 week of differentiation. It is accompanied by telomere shortening that is especially fast during the early steps of differentiation.

Telomere shortening can be accelerated by high ROS levels, because telomeres are at least partially deficient for repair of oxidative DNA damage [33, 34]. Interestingly, ROS levels increased significantly only at 2 and 3 weeks into the differentiation process, indicating that the fast telomere shortening during the 1st week must be caused by some other mechanism, possibly having to do with adaptation to telomerase loss.

An increase in ROS levels during differentiation of hESC has been shown before, using DCF staining [35]. It has been shown as well that self-renewing potential and in vivo lifespan of hematopoietic stem cells are greatly determined by the level of ROS [9]. Jang and Sharkis have reported that a low oxygen niche in bone marrow limits ROS production, resulting in better protection and higher self-renewal potential for hematopoietic stem cells [8]. Our data indicate that downregulation of major antioxidants, notably SOD2 and GPX2, might contribute to increased cellular ROS levels during differentiation. In addition, by showing a strong correlation among the increases in cellular peroxides, mitochondrially generated superoxide, and mitochondrial mass, they suggest the upregulation of mitochondrial number and/or density during differentiation as another possible cause of increased oxidative stress in the differentiated progeny of hESC. It has been shown that hESC have very few and small mitochondria with very simple cristae, whereas differentiated cells gain a normal organelle phenotype with more and regular mitochondria, together with an increase in ATP production and higher levels of cellular ROS [35, 36]. The higher ATP production was also observed during the differentiation of adult stem cells [37]. Constancy of the mitochondrial membrane potential, as shown here, means that ROS production is essentially proportional to the number of ROS-producing sites [38, 39]. In other words, both ATP production and ROS production increase in parallel with the volume density of mitochondria.

This is different from the situation found in cellular replicative senescence. During senescence, mitochondrial mass and ROS production increase, whereas the membrane potential decreases because of an upregulation of uncoupling protein(s) [40, 41]. Upregulation of mitochondrial biogenesis in senescence appears to be part of a retrograde response to dysfunctional mitochondria (and increased cellular oxidative stress), which also includes transcriptional and post-translational activation of uncoupling proteins and of antioxidant enzymes [41, 42]. There might be a threshold level for cellular oxidative stress below which such responses are not activated and that was not reached during the course of differentiation followed here. This could explain why we found no increase in UCP-2 expression (data not shown), no drop in MMP, and actual decreases in expression levels of major antioxidant enzymes despite increased oxidative stress during differentiation. This might also explain why others found an upregulation of some antioxidant enzymes (GPX1, Prx1 and 2, Cu/Zn SOD; i.e., different enzymes from the ones studied here) during stem cell differentiation [35].

During differentiation, we also found an increasing frequency of cells showing current and/or persistent DNA damage as measured by {gamma}-H2A.X immunofluorescence. We assume that some of these DNA damage foci are induced by uncapped telomeres, indicating that some cells differentiate into a senescence-like state within a short time span and after few cell divisions [27]. However, the fact that major genes involved in widely different types of DNA damage repair became progressively downregulated suggested that nontelomeric DNA damage contributed to a significant extent to the increased frequency of DNA damage foci during differentiation. There are other data that show that despite low oxidative stress, a high load of damaged proteins in ESC are eliminated during differentiation because of a boost of proteasomal activity [43].

So far, our work shows only an association, but not a causal relationship, among the three processes studied here, namely loss of telomere maintenance, increased ROS production, and decreased DNA repair. However, we strongly believe that these three processes do not simply occur in parallel during hESC differentiation but are tightly interrelated. Telomerase has been shown to provide a survival function in a telomere-independent fashion [2123].

Telomerase is transported out of the nucleus and into mitochondria under stress and during ageing [4446]. This process can interfere with mitochondrial ROS levels, as shown by Haendeler et al. [46] in endothelial cells, where it protects mitochondrial function and mitochondrial DNA integrity and decreases ROS production [47]. Thus, downregulation of telomerase during differentiation, as well as nuclear exclusion during stress and senescence, might have a causal effect on mitochondrial ROS production. In fact, overexpression of TERT in mESC [11] and hESC [48] decreased ROS production during differentiation, thus suggesting an intrinsic link between these two maintenance functions [11]. Also, both telomerase expression and ROS levels do influence DNA damage repair activities, as shown by global gene expression and functional studies [23, 34]. Although the studies described in this report do not address the impact of each maintenance function on characteristics of hESC and their differentiation potential, our ongoing and future work is focused on investigating the causal relationships between telomerase activity, antioxidant defense, and mitochondrial function.


    CONCLUSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Conclusion
 Disclosure of Potential...
 Acknowledgments
 References
 
The disposable soma theory [2] provides an evolutionary framework to understand the coordinated regulation of apparently unrelated maintenance processes. It proposes that investments into maintenance will be higher in germ line cells (and those close to the germ line) but will be downregulated as "too costly" in somatic cells. Our data show that in fact, despite increased capacity for ATP production, various maintenance functions are coordinatively downregulated during hESC differentiation.


    DISCLOSURE OF POTENTIAL CONFLICTS OF INTEREST
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Conclusion
 Disclosure of Potential...
 Acknowledgments
 References
 
The authors indicate no potential conflicts of interest.


    ACKNOWLEDGMENTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Conclusion
 Disclosure of Potential...
 Acknowledgments
 References
 
This study was funded by Biotechnology and Biological Sciences Research Council Grant BBS/B/14779 (to M.L.), Life Knowledge Park (to G.S.), and Research into Ageing Grant 252 (to G.S. and T.v.Z.). G.S. and T.W. contributed equally to this work. M.S. is currently affiliated with Centro de Investigación Príncipe Felipe, Valencia, Spain.


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Conclusion
 Disclosure of Potential...
 Acknowledgments
 References
 

  1. Hyslop LA, Armstrong L, Stojkovic M et al. Human embryonic stem cells: Biology and clinical implications. Expert Rev Mol Med 2005;7:1–21.[Medline]

  2. Kirkwood TB. Evolution of ageing. Nature 1977;270:301–304.[CrossRef][Medline]

  3. Cervantes RB, Stringer JR, Shao C et al. Embryonic stem cells and somatic cells differ in mutation frequency and type. Proc Natl Acad Sci U S A 2002;99:3586–3590.[Abstract/Free Full Text]

  4. Stambrook PJ. An ageing question: Do embryonic stem cells protect their genomes? Mech Ageing Dev 2007;128:31–35.[CrossRef][Medline]

  5. Hong Y, Stambrook PJ. Restoration of an absent G1 arrest and protection from apoptosis in embryonic stem cells after ionizing radiation. Proc Natl Acad Sci U S A 2004;101:14443–14448.[Abstract/Free Full Text]

  6. Saretzki G, Armstrong L, Leake A et al. Stress defense in murine embryonic stem cells is superior to that of various differentiated murine cells. STEM CELLS 2004;22:962–971.[Abstract/Free Full Text]

  7. Unwin RD, Smith DL, Blinco D et al. Quantitative proteomics reveals posttranslational control as a regulatory factor in primary hematopoietic stem cells. Blood 2006;107:4687–4694.[Abstract/Free Full Text]

  8. Jang YY, Sharkis SJ. A low level of reactive oxygen species selects for primitive hematopoietic stem cells that may reside in the low-oxygenic niche. Blood 2007;110:3056–3063.[Abstract/Free Full Text]

  9. Ito K, Hirao A, Arai F et al. Reactive oxygen species act through p38 MAPK to limit the lifespan of hematopoietic stem cells. Nat Med 2006;12:446–451.[CrossRef][Medline]

  10. Schmelter M, Ateghand B, Helmig S et al. Embryonic stem cells utilize reactive oxygen species as transducers of mechanical strain-induced cardiovascular differentiation. FASEB J 2006;20:1182–1184.[Abstract/Free Full Text]

  11. Armstrong L, Saretzki G, Peters H et al. Overexpression of telomerase confers growth advantage, stress resistance, and enhanced differentiation of ESCs toward the hematopoietic lineage. STEM CELLS 2005;23:516–529.[Abstract/Free Full Text]

  12. He ZP, Tan WQ, Tang YF et al. Activation, isolation, identification and in vitro proliferation of oval cells from adult rat livers. Cell Prolif 2004;37:177–187.[CrossRef][Medline]

  13. Piccoli C, Ria R, Scrima R et al. Characterization of mitochondrial and extra-mitochondrial oxygen consuming reactions in human hematopoietic stem cells. Novel evidence of the occurrence of NAD(P)H oxidase activity. J Biol Chem 2005;280:26467–26476.[Abstract/Free Full Text]

  14. St John JC, Amaral A, Bowles E et al. The analysis of mitochondria and mitochondrial DNA in human embryonic stem cells. Methods Mol Biol 2006;331:347–374.[Medline]

  15. Lyu BN, Lyu MB, Ismailov BI et al. Four hypotheses on mitochondria's role in the development and regulation of oxidative stress in the normal state, cell pathology and reversion of tumor cells. Med Hypotheses 2007;69:186–194.[CrossRef][Medline]

  16. Stojkovic M, Lako M, Stojkovic P et al. Derivation of human embryonic stem cells from day-8 blastocysts recovered after three-step in vitro culture. STEM CELLS 2004;22:790–797.[Abstract/Free Full Text]

  17. Armstrong L, Hughes O, Yung S et al. The role of PI3K/AKT, MAPK/ERK and NFkappabeta signalling in the maintenance of human embryonic stem cell pluripotency and viability highlighted by transcriptional profiling and functional analysis. Hum Mol Genet 2006;15:1894–1913.[Abstract/Free Full Text]

  18. Atkinson SP, Hoare SF, Glasspool RM et al. Lack of telomerase gene expression in alternative lengthening of telomere cells is associated with chromatin remodeling of the hTR and hTERT gene promoters. Cancer Res 2005;65:7585–7590.[Abstract/Free Full Text]

  19. Armstrong L, Lako M, Lincoln J et al. mTert expression correlates with telomerase activity during the differentiation of murine embryonic stem cells. Mech Dev 2000;97:109–116.[CrossRef][Medline]

  20. Armstrong L, Lako M, van Herpe I et al. A role for nucleoprotein Zap3 in the reduction of telomerase activity during embryonic stem cell differentiation. Mech Dev 2004;121:1509–1522.[CrossRef][Medline]

  21. Ludwig A, Saretzki G, Holm PS et al. Ribozyme cleavage of telomerase mRNA sensitizes breast epithelial cells to inhibitors of topoisomerase. Cancer Res 2001;61:3053–3061.[Abstract/Free Full Text]

  22. Zhang P, Chan SL, Fu W et al. TERT suppresses apoptosis at a premitochondrial step by a mechanism requiring reverse transcriptase activity and 14-3-3 protein-binding ability. FASEB J 2003;17:767–769.[Abstract/Free Full Text]

  23. Sharma GG, Gupta A, Wang H et al. hTERT associates with human telomeres and enhances genomic stability and DNA repair. Oncogene 2003;22:131–146.[CrossRef][Medline]

  24. Bernstein BE, Mikkelsen TS, Xie X et al. A bivalent chromatin structure marks key developmental genes in embryonic stem cells. Cell 2006;125:315–326.[CrossRef][Medline]

  25. Mukhopadhyay NK, Gordon GJ, Maulik G et al. Histone deacetylation is directly involved in desilencing the expression of the catalytic subunit of telomerase in normal lung fibroblast. J Cell Mol Med 2005;9:662–669.[CrossRef][Medline]

  26. Tanaka T, Halicka HD, Huang X et al. Constitutive histone H2AX phosphorylation and ATM activation, the reporters of DNA damage by endogenous oxidants. Cell Cycle 2006;5:1940–1945.[Medline]

  27. d'Adda di Fagagna F, Reaper PM, Clay-Farrace L et al. A DNA damage checkpoint response in telomere-initiated senescence. Nature 2003;426:194–198.[CrossRef][Medline]

  28. von Zglinicki T, Saretzki G, Ladhoff J et al. Human cell senescence as a DNA damage response. Mech Ageing Dev 2005;126:111–117.[CrossRef][Medline]

  29. Gire V, Roux P, Wynford-Thomas D et al. DNA damage checkpoint kinase Chk2 triggers replicative senescence. EMBO J 2004;23:2554–2525.[CrossRef][Medline]

  30. Stewart R, Stojkovic M, Lako M. Mechanisms of self-renewal in human embryonic stem cells. Eur J Cancer 2006;42:1257–1272.[CrossRef][Medline]

  31. Anderson CJ, Hoare SF, Ashcroft M et al. Hypoxic regulation of telomerase gene expression by transcriptional and post-transcriptional mechanisms. Oncogene 2006;25:61–69.[Medline]

  32. Serakinci N, Hoare SF, Kassem M et al. Telomerase promoter reprogramming and interaction with general transcription factors in the human mesenchymal stem cell. Regen Med 2006;1:125–131.[CrossRef][Medline]

  33. von Zglinicki T. Oxidative stress shortens telomeres. Trends Biochem Sci 2002;27:339–344.[CrossRef][Medline]

  34. Richter T, Saretzki G, Nelson G et al. TRF2 overexpression diminishes repair of telomeric single-strand breaks and accelerates telomere shortening in human fibroblasts. Mech Ageing Dev 2007;128:340–345.[CrossRef][Medline]

  35. Cho YM, Kwon S, Pak YK et al. Dynamic changes in mitochondrial biogenesis and antioxidant enzymes during the spontaneous differentiation of human embryonic stem cells. Biochem Biophys Res Commun 2006;348:1472–1478.[CrossRef][Medline]

  36. Oh SK, Kim HS, Ahn HJ, Seol HJ et al. Derivation and characterization of new human embryonic stem cell lines: SNUhES1, SNUhES2, and SNUhES3. STEM CELLS 2005;23:211–219.[Abstract/Free Full Text]

  37. Lonergan T, Brenner C, Bavister B. Differentiation-related changes in mitochondrial properties as indicators of stem cell competence. J Cell Physiol 2006;208:149–153.[CrossRef][Medline]

  38. Balaban RS, Nemoto S, Finkel T. Mitochondria, oxidants, and aging. Cell 2005;120:483–495.[CrossRef][Medline]

  39. Passos J, von Zglinicki T, Kirkwood T. Mitochondria and aging: Winning and losing in the numbers game. Bioessays 2007;29:908–917.[CrossRef][Medline]

  40. Lee HC, Yin PH, Chi CW et al. Increase in mitochondrial mass in human fibroblasts under oxidative stress and during replicative cell senescence. J Biomed Sci 2002;9:517–526.[CrossRef][Medline]

  41. Passos JF, Saretzki G, Ahmed S et al. Mitochondrial dysfunction accounts for the stochastic heterogeneity in telomere-dependent replicative senescence. PLoS Biol 2007;5:e110.[CrossRef][Medline]

  42. Echtay KS, Brand MD. 4-hydroxy-2-nonenal and uncoupling proteins: An approach for regulation of mitochondrial ROS production. Redox Rep 2007;12:26–29.[CrossRef][Medline]

  43. Hernebring M, Brolen G, Aguilaniu H et al. Elimination of damaged proteins during differentiation of embryonic stem cells. Proc Natl Acad Sci U S A 2006;103:7700–7705.[Abstract/Free Full Text]

  44. Santos JH, Meyer JN, Skorvaga M et al. Mitochondrial hTERT exacerbates free-radical-mediated mtDNA damage. Aging Cell 2004;3:399–411.[CrossRef][Medline]

  45. Haendeler J, Hoffmann J, Brandes RP et al. Hydrogen peroxide triggers nuclear export of telomerase reverse transcriptase via Src kinase family-dependent phosphorylation of tyrosine 707. Mol Cell Biol 2003;23:4598–4610.[Abstract/Free Full Text]

  46. Haendeler J, Hoffmann J, Diehl JF et al. Antioxidants inhibit nuclear export of telomerase reverse transcriptase and delay replicative senescence of endothelial cells. Circ Res 2004;94:768–775.[Abstract/Free Full Text]

  47. Del Bufalo D, Rizzo A, Trisciuoglio D et al. Involvement of hTERT in apoptosis induced by interference with Bcl-2 expression and function. Cell Death Differ 2005;12:1429–1438.[CrossRef][Medline]

  48. Yang C, Prayberski S, Cooke MJ et al. A key role for the telomerase reverse transcriptase unit (TERT) in modulating human ESC proliferation, cell cycle dynamics, and in vitro differentiation. STEM CELLS 2008; (in press).




This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
H. Summer, O. Li, Q. Bao, L. Zhan, S. Peter, P. Sathiyanathan, D. Henderson, T. Klonisch, S. D. Goodman, and P. Droge
HMGA2 exhibits dRP/AP site cleavage activity and protects cancer cells from DNA-damage-induced cytotoxicity during chemotherapy
Nucleic Acids Res., May 21, 2009; (2009) gkp375v1.
[Abstract] [Full Text] [PDF]


Home page
Hum Reprod UpdateHome page
J. Ramalho-Santos, S. Varum, S. Amaral, P. C. Mota, A. P. Sousa, and A. Amaral
Mitochondrial functionality in reproduction: from gonads and gametes to embryos and embryonic stem cells
Hum. Reprod. Update, May 4, 2009; (2009) dmp016v1.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Oh, K. S. Brammer, Y. S. J. Li, D. Teng, A. J. Engler, S. Chien, and S. Jin
Stem cell fate dictated solely by altered nanotube dimension
PNAS, February 17, 2009; 106(7): 2130 - 2135.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
S. Maynard, A. M. Swistowska, J. W. Lee, Y. Liu, S.-T. Liu, A. B. Da Cruz, M. Rao, N. C. de Souza-Pinto, X. Zeng, and V. A. Bohr
Human Embryonic Stem Cells Have Enhanced Repair of Multiple Forms of DNA Damage
Stem Cells, September 1, 2008; 26(9): 2266 - 2274.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
C. Yang, S. Przyborski, M. J. Cooke, X. Zhang, R. Stewart, G. Anyfantis, S. P. Atkinson, G. Saretzki, L. Armstrong, and M. Lako
A Key Role for Telomerase Reverse Transcriptase Unit in Modulating Human Embryonic Stem Cell Proliferation, Cell Cycle Dynamics, and In Vitro Differentiation
Stem Cells, April 1, 2008; 26(4): 850 - 863.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
2007-0628v1
26/2/455    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Saretzki, G.
Right arrow Articles by Lako, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Saretzki, G.
Right arrow Articles by Lako, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
STEM CELLS THE ONCOLOGIST CME ALPHAMED PRESS JOURNALS