HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Supplemental Data All Versions of this Article: 2007-0428v1 26/3/621    most recent Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints/Permissions Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Lahmar, M. Articles by Lauret, E. Search for Related Content PubMed PubMed Citation Articles by Lahmar, M. Articles by Lauret, E.

TISSUE-SPECIFIC STEM CELLS

Distinct Effects of the Soluble Versus Membrane-Bound Forms of the Notch Ligand Delta-4 on Human CD34⁺CD38^low Cell Expansion and Differentiation

^aInstitut National de la Santé et de la Recherche Médicale, U790, Villejuif, France;
^bInstitut Gustave Roussy, Villejuif, France;
^cParis-Sud University, Orsay, France;
^dInstitutes for Biomedical Research, Novartis, Cambridge, Massachusetts, USA

Key Words. Notch • Cell proliferation • Notch signaling

Correspondence: Correspondence: Evelyne Lauret, Ph.D., U790 INSERM, Institut Gustave Roussy, University Paris XI, PR1, 94800 Villejuif, France. Telephone: 33-1-42-11-53-73; Fax: 33-1-42-11-52-40; e-mail: elauret{at}igr.fr

Received on June 5, 2007; accepted for publication on November 19, 2007.

First published online in STEM CELLS EXPRESS  November 29, 2007.

	ABSTRACT

Top Abstract Introduction Materials and Methods Results Discussion Disclosure of Potential... Acknowledgments References

 
Although Notch ligands are considered to activate signaling through direct cell-cell contact, the existence of soluble forms has been demonstrated. However, their roles remain controversial: soluble forms have been reported to mimic the biological activity of membrane-bound form, whereas other studies rather suggested an antagonistic activity toward their full-length counterparts. We previously observed that membrane-bound Delta4-expressing S17 stroma (mbD4/S17) reduced human CD34⁺CD38^low cell proliferation and favored self-renewal. Here, we assessed the effects of a soluble form of Delta4 (solD4) by exposing CD34⁺CD38^low cells to S17 feeders engineered to express solD4 (solD4/S17). In contrast to mbD4/S17, (a) solD4/S17 increased 10-fold cell production after 2 weeks, through enhanced cell proliferation, and (b) it did not preserve colony-forming cell and long-term culture-initiating cell potential of output CD34⁺ cells. mbD4 and solD4 appeared to also differ in their signaling. Indeed, mbD4, but not solD4, strongly activated both CSL (the nuclear mediator of Notch signaling) in Hela cells overexpressing Notch1 and transcription of some classic Notch target genes in CD34⁺CD38^low cells. Furthermore, both biological effects and CSL activation elicited by mbD4 were strictly dependent upon the -secretase complex, whereas solD4 enhanced cell expansion in a partially -secretase-independent manner. Altogether, these results suggest that part of solD4 activity did not rely upon canonical Notch pathway.

Disclosure of potential conflicts of interest is found at the end of this article.

	INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion Disclosure of Potential... Acknowledgments References

 
The Notch family is a group of highly conserved cell surface receptors playing many fundamental roles in metazoan development [1]. Notch signaling is initiated through ligand-receptor interactions, triggering a series of proteolytic cleavage of Notch by TNF-converting enzyme and subsequently by the -secretase complex. These cleavages ultimately lead to the release of the Notch intracytoplasmic domain (NICD), which translocates to the nucleus, where it heterodimerizes with the transcription factor CSL (C-promoter binding factor-1, suppressor of hairless in Drosophila and Lag in Caenorhabditis elegans, also known as R-binding-protein-J in the mouse). Target genes of this canonical Notch signaling include basic helix-loop-helix transcriptional repressors of hairy enhancer of split (Hes) family and their relatives, known as Hes-related repressor proteins. Two Notch ligand families, Delta and Serrate/Jagged ligands, have been identified in mammals; they include Delta-1, -3, and -4 and Jagged-1 and -2, which activate signaling through direct cell-cell contact.

In recent years, Notch emerged as a critical element for hematopoiesis. There is accumulating evidence that Notch signaling affects survival, proliferation, and cell fate at various stages of hematopoietic development, including the decision of hematopoietic stem cells (HSC) to self-renew or differentiate [2, 3]. These influences can be evidenced by modulating the Notch signaling at various levels, including at the level of ligand expression. Indeed, culture of HSC on stroma-expressing one membrane-bound ligand (either Jagged1, Jagged2, or Delta1) increased the number of progenitor cells [4–6] or HSC survival [7]. Moreover, we previously observed that Delta4-expressing stromas reduced HSC proliferation and favored HSC self-renewal in vitro by mechanisms independent of the mitotic history [8].

Besides these membrane-bound forms of Notch ligands, the existence of soluble forms has been demonstrated in C. elegans [9] and Drosophila [10] and proposed in vertebrates [11]. Indeed, Drosophila Delta can be proteolytically cleaved by Kuzbanian, a member of a disintegrin and metalloprotease family, to generate a soluble extracellular form [12]. Recent data also suggest that mammalian Notch ligands may be cleaved by -secretase/presenilin in a manner similar to Notch proteins [13, 14]. However, the physiological roles of these diffusible ligands remain controversial. Although some data suggest that they are able to activate Notch receptors [9, 15–17], other reports indicate that they act instead as antagonists of Notch signaling by impeding the interaction of their full-length counterparts with Notch [18, 19] and are thus devoid of any activity in the absence of membrane-bound Notch ligands [20]. It is very difficult to break away from this general conundrum, because none of the reported studies have analyzed the activity of the membrane-bound and soluble forms under the same conditions. To do this, we decided to evaluate the activity of a soluble form of Delta4 (solD4) in modulating the fate of human cord blood CD34⁺CD38^low cells in vitro, using the same culture conditions previously used to evaluate the activity of membrane-bound Delta4 (mbD4) [8].

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion Disclosure of Potential... Acknowledgments References

 
Construction and Production of Retroviruses
Retroviral vector encoding a truncated soluble form of human Delta-4 cDNA was derived from the myelo proliferative sarcoma virus pac vector carrying a murine embryonic stem cell virus LTR and the puromycin N-acetyltransferase (pac) gene driven by an internal murine phosphoglycerase kinase promoter. The extracellular part of human Delta-4 comprising the first amino acid (W) of the transmembrane domain (solD4) was polymerase chain reaction (PCR)-amplified (1.587 kilobases, 5'-ATGGCG ... TTCCCCTAA-3') to introduce unique 5'-XhoI and 3'-EcoRI restriction sites and a Kozak sequence (ACCGCC) in the original cDNA (Advantage-HF kit; Clontech, Palo Alto, CA, http://www.clontech.com). The PCR products were ligated into the MSCVpac retroviral vector and verified by sequencing. Viral supernatants were generated using 293EBNA cells (Invitrogen, Carlsbad, CA, http://www.invitrogen.com) by transfecting retroviral constructs using the Exgen500 reagent (Euromedex, Souffelweyersheim, France, http://www.euromedex.com), as previously described [21].

Cell Lines
S17 and MS-5 cell lines were grown in essential medium (-Minimal Eagle Medium [-MEM]; Invitrogen) supplemented with 10% fetal calf serum (FCS; HyClone, Logan, UT, http://www.hyclone.com).

Generation of S17 Stromal Cell Populations
S17 cells were infected with 0.1 ml of viral supernatant containing the solD4-expressing vector in the presence of 4 µg/ml polybrene (Sigma-Aldrich, St. Louis, http://www.sigmaaldrich.com). Two days after infection, puromycin selection (4 µg/ml; Sigma-Aldrich) was performed to generate stably transduced cell populations. The population of S17 feeders engineered to express solD4 (solD4/S17) was the result of a mixture of at least 10 different clones.

For Western blotting, the equivalent of 20 µl of proteins from S17 supernatants and Delta4-Fc (corresponding to 40 ng per lane; the production of the Delta4-Fc protein has been described previously [8]) were ethanol-precipitated, and 200 µg of proteins from S17 cells lysed in 150 mM NaCl, 1.0% Nonidet P40, 0.5% deoxycholate, 0.1% SDS, 50 mM Tris-Cl, protease inhibitors (Roche Diagnostics, Basel, Switzerland, http://www.roche-applied-science.com) was loaded. A rabbit polyclonal antibody raised against a peptide mapping near the N terminus of human Delta4 was used at a concentration of 1.5 µg/ml in 1x Tris-buffered saline (TBS)/milk 2.5%/Tween20 0.1% (ab7280; Abcam, Cambridge, MA, http://www.abcam.com); horseradish peroxidase-conjugated goat anti-rabbit secondary antibody was used at a 1:5,000 dilution in 1x TBS/milk 5%/Tween20 0.1% (Jackson Immunoresearch Laboratories, West Grove, PA, http://www.jacksonimmuno.com). Generation and characterization of the S17 stromal cell control (C/S17) and S17 stromal cells stably engineered to express the membrane-bound form (mbD4/S17) have been described previously [8].

Cell Preparation and Labeling
Cord blood samples were obtained with informed consent according to approved institutional guidelines and were subjected to standard CD34 immunomagnetic bead separation (Miltenyi Biotec, Auburn, CA, http://www.miltenyibiotec.com). Sorting of the CD34⁺CD38^low fraction was performed using FACSDiva (Becton, Dickinson and Company, Franklin Lakes, NJ, http://www.bd.com) as previously described [22].

Coculture Experiments with Transduced S17 Stroma Cells

Basic Culture Conditions.   Cultures were initiated by plating 5,000 CD34⁺CD38^low cells in 24-well plates seeded onto S17 stromas in -MEM containing 10% FCS (StemCell Technologies, Vancouver, BC, Canada, http://www.stemcell.com). The following cytokines were added: rhu-TPO (50 ng/ml; Amgen, Thousand Oaks, CA, http://www.amgen.com), rhu-IL3 (100 U/ml; Novartis, Cambridge, MA, http://www.novartis.com), rhu-Flt-3 ligand (100 ng/ml; Amgen), and rhu-SCF (50 ng/ml; Amgen). At day 7, the cultures were disrupted by vigorous pipetting and scraping to avoid any deleterious effect of aged stroma. Nucleated cells were counted, and CD34⁺ cells were sorted and used to initiate clonogenic progenitor assay and long-term culture (LTC), and 5,000 output nucleated cells were replated onto fresh stromal layers in the cytokine-rich medium for an additional week. This procedure was performed over 2 weeks. Some cultures were performed in the presence of 10 µM N-[3,5-difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl ester (DAPT; a -secretase inhibitor; Calbiochem, San Diego) or dimethyl sulfoxide (DMSO) as a control.

Analysis of Cloning Efficiency.   Single sorted CD34⁺CD38^low cells in flat-bottomed 96-well plates were seeded onto S17 stromas with the same cytokines. At day 14, the resulting clones were examined, and their size and phenotype were evaluated by fluorescence-activated cell sorting analysis.

Analysis of Cell Cycling.   To track successive cell divisions during culture, CD34⁺CD38^low cells were labeled with carboxyfluorescein diacetate succinimidyl ester (CFSE; Molecular Probes, Eugene, OR, http://probes.invitrogen.com) as previously described [23], cultured on the S17 stromas, as described above, and analyzed 3 days later on FACSort (Becton Dickinson).

Activity of the Conditioned Medium.   Five thousand CD34⁺CD38^low cells were plated in 24-well plates in -MEM containing 10% FCS + 80% of freshly prepared 24-hour conditioned media harvested from confluent monolayers of S17 cells supplemented with previously described cytokines. Every 2 days, 80% of the medium was removed and replaced by 0.8 ml of fresh conditioned media supplemented with cytokines. At day 7, nucleated cells were counted, and 5,000 cells were replated into a new 24-well plate for an additional week of culture under the same culture conditions.

Activity of Delta4-Fc Protein.   CD34⁺CD38^low cells were plated and maintained for 2 weeks in StemSpam medium (StemCell Technologies) supplemented with cytokines in the presence of 0.5 or 2 µg/ml Delta4-Fc. Human IgG1 was used as control.

Cell Cycle and Apoptosis Analyses

Cell Cycle.   During cultures, output nucleated cells were resuspended at 5 x 10⁶ cells per milliliter in 0.15 mol/l NaCl, 0.1 mol/l Tris-HCl, pH 7.6, and then diluted with 20 volumes of 0.1% (wt/vol) sodium citrate, pH 7.6, 10 mmol/l NaCl, 50 mg/ml RNase A, 0.1% Nonidet P40, and 10 µg/ml 7-aminoactinomycin D (7-AAD). The cells were incubated at 4°C for 24 hours before flow cytometric analysis. At least 10,000 cells per sample were analyzed for cell cycle progression.

Apoptosis.   During cultures, nucleated cells were pelleted, washed once with 1x phosphate-buffered saline and once in AnnexinV-binding buffer (10 mM HEPES, pH 7.4, 140 mM NaCl, 2.5 mM CaCl₂), and incubated on ice for 15 minutes in the dark after addition of 1 µl AnnexinV-fluorescein isothiocyanate and 10 µg/ml 7-AAD.

Differentiation Potential Assays
Quantification of CD34⁺ cells, colony-forming cell (CFC), and long-term culture-initiating cell (LTC-IC) potential was performed using standard methylcellulose colony assay using previously described criteria [24].

Hela/N1 Transfection and Luciferase Measurements
pJH23A (4xwtCBF1Luc) and pJH25A (4xmtCBF1Luc) expression vectors were a gift from S. Hayward [25]. pJH23A contains four copies of the wild-type (GATCTGGTGTAACACGCCGTGGGAAAAAATTTATG) and pJH25A the mutant (GATCTGGTGTAAACACGGGCTTGGAAAAAATTTATG) CSL-binding element cloned upstream of a SV40 promoter-driven luciferase reporter construct, pGL2pro (Promega, Madison, WI, http://www.promega.com). Hela/N1 cells overexpressing the full-length murine Notch1 [26] were grown in Dulbecco's modified Eagle's medium containing 10% FCS. In a 48-mm dish, 2 x 10⁴ cells were seeded 24 hours before transfection using FuGENE reagent (Roche Diagnostics). Total DNA for transfection was 0.4 µg of pJH23A or pJH25A expression vectors and 0.025 µg of a β-galactosidase-encoding vector (pEF1-βgal) to correct for variation in transfection efficiency. Twenty-four hours after transfection, Hela/N1 cells were plated onto either C/S17, mbD4/S17, or solD4/S17 or in the presence of 10 µM DAPT or of its vehicle (DMSO). Twenty-four hours later, cells were lysed and examined for luciferase and β-galactosidase expression [27].

Real-Time Reverse Transcription-PCR Studies
Total RNA was extracted using the Trizol Reagent Kit (Invitrogen) before synthesizing cDNA using the SuperScriptII kit (Invitrogen). Primers and probes of each gene were as follows: Hes1, forward, 5'-TGGAAATGACAGTGAAGCACCT-3'; reverse, 5'-GTTCATGCACTCGCTGAAGC-3'; and probe, 5'-GCGAGATGACGGCGTCGCTG-3'; Deltex1, forward, 5'-TGCTATCTACCCAACAACGAGAAA-3'; reverse, 5'-TCTCCCAGGCCGTGATGA-3'; and probe, 5'-CCGGAAGGTGCTGCGGCTG-3'; Hey1, forward, 5'-GCATACGGCAGGAGGGAAA-3'; reverse, 5'-TCCCAAAC-TCCGATAGTCCATAG-3'; and probe, 5'-TACTTTGACGCG-CACGCCCT-3'; and Hey2, forward, 5'-AAAGCTGAAATAT-TGCAAATGACAGT-3'; reverse, 5'-AAGAGCGTGTGCGTCA-AAGTAG-3'; and probe, 5'-CATTTGAAGATGCTTCAGGCA-ACAGGG-3'. Probes were labeled at the 5' end with FAM and at the 3' end with TAMRA (Eurogentec, Liège, Belgium, http://www.eurogentec.be). The hypoxanthine phosphoribosyltransferase (HPRT) transcript was used as endogenous constant control (HPRT, forward, 5'-GGCAGTATAATCCAAAGATGGTCAA-3'; reverse, 5'-TCAAATCCAACAAAGTCTGGCTTATAT-3'; and probe, 5'-CTTGCTGGTGAAAAGGACCCCACGA-3'). PCR amplification was carried out for 10 minutes at 95°C followed by 50 cycles (1 minute at 60°C and 15 seconds at 95°C) in an ABI Prism 3100 instrument (Applied Biosystems, Foster City, CA, http://www.appliedbiosystems.com). The mRNA expression of each gene was normalized to that of HPRT mRNA and calibrated to the gene/HPRT ratio with endogenous standard in human erythroleukemia cells (American Type Culture Collection, Manassas, VA, http://www.atcc.org) as a positive standard (normalized target value).

Statistical Analysis
Statistical significance was determined by the Student t test (paired data analysis).

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion Disclosure of Potential... Acknowledgments References

 
Coculture Conditions on solD4/S17 Cells
To assess the effects of solD4 in modulating HSC fate and rigorously compare them with those of mbD4, we followed the same strategy described previously [8]. We established S17 feeder cell lines transduced with either control (C/S17) or solD4-expressing vectors (solD4/S17). solD4 in the solD4/S17 supernatant was present at a concentration of approximately 2 µg/ml (Fig. 1). The effect of solD4 on the progeny of HSC in culture was examined by plating CD34⁺CD38^low cord blood cells onto the engineered stromas. At day 7, nucleated cells were enumerated, and output CD34⁺ cells were counted and studied to determine their CFC and LTC-IC potential. Output nucleated cells were also plated onto fresh stromas, and their progeny were analyzed at day 14.

View larger version (41K): [in this window] [in a new window]   Figure 1. Detection of solD4, mbD4, and D4Fc. solD4 (58 kDa) present in the supernatant and in the lysate of solD4/S17, mbD4 (76 kDa) present in the lysate of mbD4/S17, and D4Fc (100 kDa) were detected by Western blot. Column A was loaded with 40 ng of D4Fc, column B shows the position of the molecular weight markers (Fermentas, Burlington, ON, Canada, http://www.fermentas.com), column C was loaded with the equivalent of 20 µl of solD4/S17 supernatant, column D with the equivalent of 20 µl of C/S17 supernatant, column E with 200 µg of mbD4/S17 protein lysate, column F with 200 µg of C/S17 protein lysate, and column G with 200 µg of solD4/S17 protein lysate. The intensities of the solD4 and D4Fc bands were quite similar, indicating that solD4/S17 supernatant contained approximately 2 µg/ml solD4 (approximately 40 ng in 20 µl). Abbreviations: C/S17, S17 stromal cell control; D4Fc, Delta4-Fc; M, molecular weight marker; mbD4/S17, membrane-bound Delta4-expressing S17 stroma; solD4/S17, S17 feeders engineered to express a soluble form of Delta4.

View larger version (26K): [in this window] [in a new window]   Figure 2. Effect of solD4/S17 cells on nucleated cells during the 2-week culture. (A): Effect on total cell number. The cells produced by 5,000 CD34+CD38low cells cultured on C/S17, mbD4/S17, or solD4/S17 stromas were harvested at d7 and counted. Five thousand output nucleated cells were replated onto the three S17 stromas for another week of culture. The fold increase was calculated as the cell number at the indicated time of culture divided by the cell number at d0 (5,000) (four experiments). (B): Size of clones generated by single CD34+CD38low cells cultured for 14 d on the C/S17, mbD4/S17, and solD4/S17 stromas. The number of nucleated cells in each well was estimated at d14 by fluorescence-activated cell sorting analysis (mean of three samples). (C): Proliferation analysis of CFSE-labeled CD34+CD38low cells cultured on C/S17 or solD4/S17 stromas. Distribution of CD34+CD38low cells according to the peaks of fluorescence after 3 d in culture. Each peak corresponds to a cell generation and is numbered by reference to the zero-division point defined by analyzing an aliquot of the cells kept at 4°C (three different experiments). Abbreviations: C/S17, S17 stromal cell control; CFSE, carboxyfluorescein diacetate succinimidyl enterdye; d, day(s); mbD4/S17, membrane-bound Delta4-expressing S17 stroma; Nb, number; solD4/S17, S17 feeders engineered to express a soluble form of Delta4.

solD4/S17 Does Not Maintain the Primitive Potential
We have previously shown that mbD4 lowered in vitro the loss of primitive potential by maintaining a higher proportion of CD34⁺ cells, characterized by a high CFC and LTC-IC potential [8]. We therefore investigated whether solD4/S17 displayed such an activity. At 7 days of culture, no difference in the percentage of output CD34⁺ cells was observed (92% ± 5%, 94% ± 2%, and 94% ± 2% for C/S17, mbD4/S17, and solD4/S17, respectively) whereas at day 14, the population maintained on mbD4/S17 displayed a higher rate of CD34+ cells (30% ± 4%, 66% ± 0%, and 37% ± 3% of CD34+ cells for C/S17, mbD4/S17, and solD4/S17, respectively) with a concomitant decrease in the proportion of differentiated myeloid cells. No major differences were observed in the phenotype of cells grown onto C/S17 and solD4/S17 except a reduced proportion of macrophagic CD14⁺CD15⁺ cells and CD41⁺ cells (supplemental online data 2A). The same kind of analysis performed at the single-cell level also showed that solD4, in contrast to mbD4, did not block the differentiation of CD34⁺ cells (supplemental online data 2B). In addition, we did not observe any significant difference in the CFC potential of output CD34⁺ cells grown onto C/S17 and solD4/S17 (supplemental online data 3). LTC-IC frequencies of output CD34⁺ cells grown for 7 days on solD4/S17 and C/S17 (Table 1) were similarly diminished (0.02 ± 0.02; p < .01; n = 5), compared with that in input CD34⁺CD38^low cells (0.18 ± 0.07) and in output CD34⁺ cells grown on mbD4/S17 (0.14 ± 0.04). Nevertheless, solD4/S17, by enhancing cell production, induced a slight expansion of LTC-IC, as compared with C/S17: from 5,000 input CD34⁺CD38^low cells containing initially an average of 915 ± 463 LTC-IC, the mean production at day 7 was 2,985 ± 847 for solD4/S17 compared with 1,660 ± 444 LTC-IC for C/S17 and 4,765 ± 1,900 LTC-IC for mbD4/S17. We conclude that solD4/S17 activity differs from that of mbD4/S17 in at least two respects: (a) it accelerates cell production, whereas mbD4 decreases it [8], and (b) it does not influence the spontaneous loss of the primitive potential of CD34⁺ cells upon cell culture, whereas mbD4 limits the extent of this process.

Differences in mb- and solD4 Transduction Pathways
We next investigated the mechanisms underlying mb- and solD4 activities on CD34 ⁺CD38^low cells. In the prevailing model, ligand binding to Notch receptors triggers Notch cleavage by the -secretase complex, releasing NICD, which in turn, is translocated into the nucleus to activate transcription of target genes (such as Hes1) by interacting with the DNA-bound transcription factor CSL. Moreover, besides this "canonical" Notch signaling, some reports suggest CSL-independent pathways [28]. We first assessed whether mbD4 and solD4 activities required the -secretase complex activity. For this purpose, CD34⁺CD38^low cells were cultivated onto S17 stromas in the presence of DAPT, an inhibitor of the -secretase complex. The results presented in Figure 3 show that after 7 days of culture, DAPT completely counteracted the influence of mbD4/S17 on cell production (Fig. 3A; p < .01; n = 5). Moreover, when the culture was prolonged for another week, DAPT also totally abrogated the persistence of a high proportion of CD34⁺ cells in the culture (Fig. 3B; 65% ± 3% for mbD4/S17 vs. 30% ± 5% for mbD4/S17+DAPT and 28% ± 3% for C/S17). These results show that the -secretase complex is absolutely required for mbD4 to reduce cell proliferation and preserve the primitive potential. Concerning solD4 (Fig. 3C), DAPT at the same concentration only partially diminished the enhanced cell production (x115 ± 35 for solD4/S17 vs. x72 ± 21 for solD4/S17+DAPT; p < .05). The use of a higher DAPT concentration in the culture (30 µM vs. 10 µM) did not enhance its blocking activity toward solD4 effects (data not shown). These data suggest that only part of solD4 activity, in contrast to all mbD4 activity, depends on the release of NICD by the -secretase complex.

View larger version (33K): [in this window] [in a new window]   Figure 3. mbD4/S17, solD4/S17, and the canonical Notch signaling. Five thousand CD34+CD38low cells were seeded on wells coated with C/S17, mbD4/S17, or solD4/S17 stroma with or without N-[3,5-difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl ester (DAPT) (10 µM). Cells were harvested at day 7 and counted. Cultures onto C/S17 and mbD4/S17 were prolonged for another week, and cells were enumerated and analyzed for CD34+ cells. Cultures performed in the presence of DMSO served as control. (A): The fold increase in the total cell number onto C/S17 and mbD4/S17 was calculated as the cell number at day 7 divided by the cell number at day 0, and the results are expressed as the relative expansion compared with C/S17. (B): Percentage of CD34+ cells after 14 days of cultures onto C/S17 and mbD4/S17. (C): The fold increase in the total cell number onto C/S17 and solD4/S17 was calculated as the cell number at day 7 divided by the cell number at day 0, and the results are expressed as the relative expansion compared with control. (D): Hela cells overexpressing the murine Notch1 (Hela/N1) were cotransfected with pJH23A (4xwtCBF1Luc) or pJH25A (4xmtCBF1Luc) expression vectors and a β-galactosidase expression vector. Twenty-four hours later, transfected Hela/N1 cells were seeded onto the three S17 stromas with DAPT or its vehicle (DMSO). Luciferase activity was measured 24 hours later and normalized to β-galactosidase activity as an internal control. Values are mean ± SEM (n = 5). **, p < .01; *, p < .05. Abbreviations: SI, gamma secretase inhibitor; C/S17, S17 stromal cell control; DMSO, dimethyl sulfoxide; mbD4/S17, membrane-bound Delta4-expressing S17 stroma; solD4/S17, S17 feeders engineered to express a soluble form of Delta4.

Finally, we determined whether mbD4 and solD4 could differentially regulate some well-known Notch target genes. We measured the expression of these genes in output cells cultured onto mbD4/S17, solD4/S17, and C/S17 at two time points (1 and 9–10 days, when these populations still contained around 85% of CD34⁺ cells) (Table 2). At day 1, exposure of CD34⁺CD38^low cells to mbD4/S17 induced a 19-fold increase and a 5-fold increase in Hes1 and Hey1 expression, respectively (n = 3), but had no significant effect on Hey2 expression or on Deltex1. At 9–10 days of culture, expression of Hes1 (x125), Hey1 (x16), Hey2 (x30), and Deltex1 (x1,400) increased markedly. In contrast, after 1 day of culture, output CD34⁺ cells exposed to solD4/S17 did not display any significant increase in the expression of these four genes, whereas after 9–10 days of culture, we observed an enhanced Hey1 expression (x3), a twofold decreased Deltex1 expression, and no modulation of Hes1 and Hey2. Taken together, these results indicate that exposure of CD34⁺ cells to mbD4 leads to a substantial upregulation of Hes1, Hey1, and Hey2 expression, with a more pronounced effect at day 9 of culture. In contrast, solD4 induced only slight modifications of some Notch target genes at day 9. Thus, although mbD4 and solD4 are considered to interact with the same cell receptors, mbD4 was much more efficient than solD4 in regulating some well-known Notch target genes. This conclusion was confirmed by analyzing Hes1 expression in CD34⁺ cells cultured in the presence of various doses of immobilized or soluble Delta4-Fc (supplemental online data 5). Whereas we observed a 5-, 12-, and 12-fold upregulation of Hes1 in CD34⁺ cells exposed to 2, 5, and 10 µg/ml immobilized Delta4-Fc, respectively, a modest nonsignificant upregulation of Hes1 was noticed in CD34⁺ cells exposed to 2 µg/ml soluble Delta4-Fc, and a twofold downmodulation was seen in cells exposed to 5 µg/ml soluble Delta4-Fc. Altogether, these data suggest that different signaling pathways underlie the distinct effects of mbD4 and solD4: whereas mbD4 appears to elicit a canonical Notch signaling, solD4 acts partly independently of -secretase-mediated Notch cleavage and without significantly inducing CSL activation or the transcription of some CSL-regulated Notch target genes.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion Disclosure of Potential... Acknowledgments References

The increase in cell expansion after solD4 exposure appears to be due to accelerated cell proliferation. Although most studies devoted to the role of Notch ligands on HSC report an increase in progenitor cell number in the cultures exposed to the ligands [4–6, 15, 16, 30, 31], only a few of them have explored the mechanisms responsible for this effect. Jagged2-expressing stroma enables the survival and the proliferation of murine lin^–ckit⁺ cells in the absence of exogenous cytokines [7]. In addition, exposure of lin^– cells to a soluble form of human Delta1 reduces apoptosis and increases the fraction of cells in S phase [17]. This was also reported in the HL60 cell context, where constitutive Notch1 expression reduces the proportion of cells in G1 and enhances that of cells in S and G2/M phases [4]. These data differ from ours, since solD4 augments cell production by enhancing proliferation without modifying the distribution of cells in the different phases of the cell cycle. The mechanisms by which solD4 enhances proliferation remain to be explored.

What could be the mechanisms by which Delta4 exerts distinct effects on HSC according to its form? First, the dosage of Notch ligand (as immobilized protein mimicking the membrane-bound form) [8, 31] can be an important parameter for Notch signaling. Indeed, Delta1 exerted dose-dependent effects on ex vivo differentiation and in vivo marrow-repopulating ability of cord blood cells [32, 33]. We have evaluated the effects of different dosages of immobilized Delta4Fc (from 1 to 10 µg/ml) on CD34⁺ cells in culture; all of them reduced cell proliferation, maintained the LTC-IC potential, and enhanced Hes1 expression (data not shown; supplemental online data 5). The same kind of dose-response test was performed with soluble Delta4Fc, but high doses (>5 µg/ml) were toxic for CD34⁺ cells in culture (probably because of some molecules distinct from Delta4Fc; data not shown). These results strongly suggest that the distinct activities of soluble versus immobilized Delta4-Fc are indeed linked to their way of presentation and not to their dose.

One can hypothesize that different presentations lead to different interactions with the Notch receptors (as monomer for solD4 or as multimers for mbD4) which, in turn, trigger distinct signaling cascades and transcriptional responses. As a second step, we thus examined the requirement of the -secretase complex in mbD4 and solD4 activities. Interestingly, whereas all tested mbD4 activities were totally abolished in the presence of a -secretase inhibitor, the effect of solD4 on cell proliferation was only partially inhibited. This result suggests that although the -secretase complex (and hence Notch cleavage) is involved in the activity of both Delta4 forms, part of solD4 activity is independent of this proteolytic activation. Interestingly, Notch was recently reported to mediate a weakened, but significant, signal in cells devoid of presenilins 1 and 2 (PS1/2), which are considered the integral proteolytic components of the -secretase complex. However, such data are not easy to interpret given the murkiness surrounding the -secretase complex. For instance, it is not clear whether what is called -secretase complex comprises PS1/2 or depends upon but does not contain these two proteases. Other studies even suggest that -secretase works independently of PS1/2 [34], whereas PS1/2 appear to act independently of the -secretase complex in presomitic mesoderm formation [35]. Notch remains able to mediate a transcriptional response, which is yet inhibited by one -secretase inhibitor distinct from DAPT [36]. Altogether, these uncertainties make it difficult to unambiguously demonstrate that solD4 acts in a -secretase-independent manner and to fully characterize such "unconventional" signaling.

We next assessed the implication of CSL in mbD4 and solD4 activity, and our results clearly indicated that mbD4 but not solD4 significantly activate CSL. Thus, according to its form, Delta4 differentially activates the canonical Notch pathway. We finally examined the transcriptional modulation of well-known Notch target genes, three of them being directly regulated by CSL (Hes1, Hey1, and Hey2). Hes1 upregulation has been already observed in CD34⁺ cells exposed to immobilized Delta1-Fc [30], and Hes1 overexpression in HSC is correlated with an improvement of their maintenance ex vivo and an accumulation of side population cells in vivo [37]. Furthermore, a recent paper suggests a key role of Hes1 in inhibiting HSC proliferation [38]. Hey1 and Hey2 have been described as general effectors of Notch signaling in other cell systems [39], and Hey1 has been identified in CD34⁺ cells as an effector of c-Jun in induced block of erythropoiesis by binding and inhibiting GATA-1 [40]. Until now, nothing has been reported regarding Hey1 and Hey2 expression in CD34⁺ cells exposed to Notch ligands. Deltex is both a target and a mediator of Notch signaling [41–43]. In hematopoietic differentiation, Deltex1 has been demonstrated to negatively modify Notch1 signaling and consequently redirect lymphoid progenitors toward B lineage [44]. In our study, a 1-day exposure to mbD4 induced Hes1 and Hey1 upregulation in output CD34⁺ cells and, 9 days later, a huge upregulation of all Notch target genes studied. The drastic difference in Deltex1 expression between control and mbD4-exposed cultures could be explained, at least partly, by an indirect effect relying on phenotypic difference in the population analyzed: although both cultures still contained more than 85% of CD34⁺ cells, 60% of CD34⁺ cells in mbD4 cultures expressed CD45RA/CD7 (lymphoid-committed precursor phenotype) versus 20% in control cultures [8]. Thus, upregulation of Deltex1 expression may only reflect the higher proportion of lymphoid cells known to upregulate Deltex1 [45]. In contrast, analysis of gene pattern response to solD4 in output CD34⁺ cells revealed no significant upregulation of Hey1 and Hey2 and a downmodulation of Deltex1 after a 1-day exposure. Significant, albeit weak, Hey1 upregulation and Deltex1 downregulation were still observed after 9 days of culture, although both populations (control and solD4 cultures) did not display any phenotypic difference (data not shown). Taken together, analysis of the gene expression pattern is in agreement with the results concerning CSL activation and reveals that mbD4 and solD4 differentially modulate gene expression, with mbD4 being overall much more efficient than solD4 in inducing four well-known transcriptional targets of Notch.

How could two different forms of Delta4 displaying distinct effects regulate the fate of HSC? Interestingly, besides the endosteal bone marrow HSC niche, the presence of a second specialized HSC microenvironment in the bone marrow has recently been postulated, as a large proportion of CD150⁺ HSC, mainly quiescent, were observed attached to the fenestrated endothelium of bone marrow sinusoids [46]. Since endothelial cells express mainly mbD4, one can postulate that mbD4 could participate in HSC quiescence. Moreover, the probability of HSC to enter cell cycle, proliferate, and undergo differentiation correlates with their distance from the hematopoietic niche. Therefore, diffusible solD4 could also promote HSC proliferation without preventing differentiation of HSC, away from the niche, leading to the complementary participation of both forms of Delta4 in the homeostasis of HSC niche.

In conclusion, solD4 appears to exert an activity distinct from the one displayed by mbD4 on human CD34⁺CD38^low cells: whereas mbD4 reduces HSC proliferation with maintenance of their primitive potential, solD4 promotes the proliferation of HSC, without maintaining their primitive potential. Moreover, mbD4 and solD4 differ both in their biological activities and, probably, in their signaling pathways. Thus, although the mechanisms by which Delta4 exerts opposite effects remain puzzling, identification of molecules involved in mbD4 and solD4 activities is of interest from the perspective of developing new approaches for HSC expansion and transplantation.

	DISCLOSURE OF POTENTIAL CONFLICTS OF INTEREST

Top Abstract Introduction Materials and Methods Results Discussion Disclosure of Potential... Acknowledgments References

 
The authors indicate no potential conflicts of interest.

	ACKNOWLEDGMENTS

Top Abstract Introduction Materials and Methods Results Discussion Disclosure of Potential... Acknowledgments References

 
The dominant-negative version of CSL and Hela/N1 cells overexpressing the murine Notch1 were kindly provided by A. Israel and C. Brou (Pasteur France). We also thank the midwives and nurses who helped us to collect cord blood samples (Longjumeau Hospital and Maternité des Lilas). We thank F. Larbret and Y. Lécluse for performing the cell sorting. We are indebted to Amgen for providing us with rhu-SCF, Kirin Brewery Co. (Tokyo) for rhu-PEG-MDGF, Immunex (Seattle) for Flt3-ligand, Novartis for rhu-IL-3, Cilag (Schaffhausen, Switzerland) for rhu-EPO, and Dr. Dorshkind for S17 cells. We thank A. Bennaceur-Griscelli for helpful discussions and I. Godin for critically reading the manuscript. C.C. is a fellow of the French Research Ministry. This work was supported by grants from Institut National de la Santé et de la Recherche Médicale, Institut Gustave Roussy (Contrat de Recherche Clinique no. 2000.10 and CRI-SPS-2003-02), Association de Recherche contre le Cancer (Grant 4300), and Atelier Thérapie Cellulaire Cellules Souches. M.L. and C.C. contributed equally to this work.

	REFERENCES

Top Abstract Introduction Materials and Methods Results Discussion Disclosure of Potential... Acknowledgments References

 

1. Artavanis-Tsakonas S, Rand M, Lake R. Notch signaling: Cell fate control and signal integration in development. Science 1999;284:770–776.[Abstract/Free Full Text]

2. Ohishi K, Katayama N, Shiku H et al. Notch signalling in hematopoiesis. Semin Cell Dev Biol 2003;14:143–150.[CrossRef][Medline]

3. Radtke F, Wilson A, Mancini SJ et al. Notch regulation of lymphocyte development and function. Nat Immunol 2004;5:247–253.[CrossRef][Medline]

4. Carlesso N, Aster JC, Sklar J et al. Notch1-induced delay of human hematopoietic progenitor cell differentiation is associated with altered cell cycle kinetics. Blood 1999;93:838–848.[Abstract/Free Full Text]

5. Varnum-Finney B, Purton LE, Yu M et al. The Notch ligand, Jagged-1, influences the development of primitive hematopoietic precursor cells. Blood 1998;91:4084–4091.[Abstract/Free Full Text]

6. Jones P, May G, Healy L et al. Stromal expression of Jagged 1 promotes colony formation by fetal hematopoietic progenitor cells. Blood 1998;92:1505–1511.[Abstract/Free Full Text]

7. Tsai S, Fero J, Bartelmez S. Mouse Jagged2 is differentially expressed in hematopoietic progenitors and endothelial cells and promotes the survival and proliferation of hematopoietic progenitors by direct cell-to-cell contact. Blood 2000;96:950–957.[Abstract/Free Full Text]

8. Lauret E, Catelain C, Titeux M et al. Membrane-bound Delta-4 Notch ligand reduces the proliferative activity of primitive human hematopoietic CD34(+)CD38(low) cells while maintaining their LTC-IC potential. Leukemia 2004;18:788–797.[CrossRef][Medline]

9. Chen N, Greenwald I. The lateral signal for LIN-12/Notch in C. elegans vulval development comprises redundant secreted and transmembrane DSL proteins. Dev Cell 2004;6:183–192.[CrossRef][Medline]

10. Klueg KM, Parody TR, Muskavitch MA. Complex proteolytic processing acts on Delta, a transmembrane ligand for Notch, during Drosophila development. Mol Biol Cell 1998;9:1709–1723.[Abstract/Free Full Text]

11. Zimrin AB, Pepper MS, McMahon GA et al. An antisense oligonucleotide to the notch ligand jagged enhances fibroblast growth factor-induced angiogenesis in vitro. J Biol Chem 1996;271:32499–32502.[Abstract/Free Full Text]

12. Qi H, Rand MD, Wu X et al. Processing of the notch ligand delta by the metalloprotease Kuzbanian. Science 1999;283:91–94.[Abstract/Free Full Text]

13. Six E, Ndiaye D, Laabi Y et al. The Notch ligand Delta1 is sequentially cleaved by an ADAM protease and gamma-secretase. Proc Natl Acad Sci U S A 2003;100:7638–7643.[Abstract/Free Full Text]

14. LaVoie MJ, Selkoe DJ. The Notch ligands, Jagged and Delta, are sequentially processed by alpha-secretase and presenilin/gamma-secretase and release signaling fragments. J Biol Chem 2003;278:34427–34437.[Abstract/Free Full Text]

15. Karanu FN, Murdoch B, Gallacher L et al. The notch ligand jagged-1 represents a novel growth factor of human hematopoietic stem cells. J Exp Med 2000;192:1365–1372.[Abstract/Free Full Text]

16. Karanu FN, Murdoch B, Miyabayashi T et al. Human homologues of Delta-1 and Delta-4 function as mitogenic regulators of primitive human hematopoietic cells. Blood 2001;97:1960–1967.[Abstract/Free Full Text]

17. Han W, Ye Q, Moore MA. A soluble form of human Delta-like-1 inhibits differentiation of hematopoietic progenitor cells. Blood 2000;95:1616–1625.[Abstract/Free Full Text]

18. Hukriede NA, Gu Y, Fleming RJ. A dominant-negative form of Serrate acts as a general antagonist of Notch activation. Development 1997;124:3427–3437.[Abstract]

19. Sun X, Artavanis-Tsakonas S. Secreted forms of DELTA and SERRATE define antagonists of Notch signaling in Drosophila. Development 1997;124:3439–3448.[Abstract]

20. Mishra-Gorur K, Rand MD, Perez-Villamil B et al. Down-regulation of Delta by proteolytic processing. J Cell Biol 2002;159:313–324.[Abstract/Free Full Text]

21. Dugray A, Geay JF, Foudi A et al. Rapid generation of a tetracycline-inducible BCR-ABL defective retrovirus using a single autoregulatory retroviral cassette. Leukemia 2001;15:1658–1662.[CrossRef][Medline]

22. Bennaceur-Griscelli A, Tourino C, Izac B et al. Murine stromal cells counteract the loss of long-term culture-initiating cell potential induced by cytokines in CD34+CD38low/neg human bone marrow cells. Blood 1999;94:529–538.[Abstract/Free Full Text]

23. Bennaceur-Griscelli A, Pondarre C, Schiavon V et al. Stromal cells retard the differentiation of CD34(+)CD38(low/neg) human primitive progenitors exposed to cytokines independent of their mitotic history. Blood 2001;97:435–441.[Abstract/Free Full Text]

24. Croisille L, Auffray I, Katz A et al. Hydrocortisone differentially affects the ability of murine stromal cells and human marrow-derived adherent cells to promote the differentiation of CD34++/CD38- long-term culture-initiating cells. Blood 1994;84:4116–4124.[Abstract/Free Full Text]

25. Hsieh JJ, Henkel T, Salmon P et al. Truncated mammalian Notch1 activates CBF1/RBPJk-repressed genes by a mechanism resembling that of Epstein-Barr virus EBNA2. Mol Cell Biol 1996;16:952–959.[Abstract]

26. Logeat F, Bessia C, Brou C et al. The Notch1 receptor is cleaved constitutively by a furin-like convertase. Proc Natl Acad Sci U S A 1998;95:8108–8112.[Abstract/Free Full Text]

27. Dhordain P, Albagli O, Lin RJ et al. Corepressor SMRT binds the BTB/POZ repressing domain of the LAZ3/BCL6 oncoprotein. Proc Natl Acad Sci U S A 1997;94:10762–10767.[Abstract/Free Full Text]

28. Martinez Arias A, Zecchini V, Brennan K. CSL-independent Notch signalling: A checkpoint in cell fate decisions during development? Curr Opin Genet Dev 2002;12:524–533.[CrossRef][Medline]

29. Duncan AW, Rattis FM, Dimascio LN et al. Integration of Notch and Wnt signaling in hematopoietic stem cell maintenance. Nat Immunol 2005;23:23.

30. Ohishi K, Varnum-Finney B, Bernstein ID. Delta-1 enhances marrow and thymus repopulating ability of human CD34(+)CD38(-) cord blood cells. J Clin Invest 2002;110:1165–1174.[CrossRef][Medline]

31. Varnum-Finney B, Brashem-Stein C, Bernstein ID. Combined effects of Notch signaling and cytokines induce a multiple log increase in precursors with lymphoid and myeloid reconstituting ability. Blood 2003;101:1784–1789.[Abstract/Free Full Text]

32. Dallas MH, Varnum-Finney B, Delaney C et al. Density of the Notch ligand Delta1 determines generation of B and T cell precursors from hematopoietic stem cells. J Exp Med 2005;201:1361–1366.[Abstract/Free Full Text]

33. Delaney C, Varnum-Finney B, Aoyama K et al. Dose-dependent effects of the Notch ligand Delta1 on ex vivo differentiation and in vivo marrow repopulating ability of cord blood cells. Blood 2005;106:2693–2699.[Abstract/Free Full Text]

34. Armogida M, Petit A, Vincent B et al. Endogenous beta-amyloid production in presenilin-deficient embryonic mouse fibroblasts. Nat Cell Biol 2001;3:1030–1033.[CrossRef][Medline]

35. Huppert SS, Ilagan MX, De Strooper B et al. Analysis of Notch function in presomitic mesoderm suggests a gamma-secretase-independent role for presenilins in somite differentiation. Dev Cell 2005;8:677–688.[CrossRef][Medline]

36. Berechid BE, Kitzmann M, Foltz DR et al. Identification and characterization of presenilin-independent Notch signaling. J Biol Chem 2002;277:8154–8165.[Abstract/Free Full Text]

37. Kunisato A, Chiba S, Nakagami-Yamaguchi E et al. HES-1 preserves purified hematopoietic stem cells ex vivo and accumulates side population cells in vivo. Blood 2003;101:1777–1783.[Abstract/Free Full Text]

38. Yu X, Alder JK, Chun JH et al. HES1 inhibits cycling of hematopoietic progenitor cells via DNA binding. STEM CELLS 2006;24:876–888.[Abstract/Free Full Text]

39. Iso T, Kedes L, Hamamori Y. HES and HERP families: Multiple effectors of the Notch signaling pathway. J Cell Physiol 2003;194:237–255.[CrossRef][Medline]

40. Elagib KE, Xiao M, Hussaini IM et al. Jun blockade of erythropoiesis: Role for repression of GATA-1 by HERP2. Mol Cell Biol 2004;24:7779–7794.[Abstract/Free Full Text]

41. Xu T, Artavanis-Tsakonas S. deltex, a locus interacting with the neurogenic genes, Notch, Delta and mastermind in Drosophila melanogaster. Genetics 1990;126:665–677.[Abstract]

42. Diederich RJ, Matsuno K, Hing H et al. Cytosolic interaction between deltex and Notch ankyrin repeats implicates deltex in the Notch signaling pathway. Development 1994;120:473–481.[Abstract]

43. Matsuno K, Diederich RJ, Go MJ et al. Deltex acts as a positive regulator of Notch signaling through interactions with the Notch ankyrin repeats. Development 1995;121:2633–2644.[Abstract]

44. Izon DJ, Aster JC, He Y et al. Deltex1 redirects lymphoid progenitors to the B cell lineage by antagonizing Notch1. Immunity 2002;16:231–243.[CrossRef][Medline]

45. Deftos ML, Huang E, Ojala EW et al. Notch1 signaling promotes the maturation of CD4 and CD8 SP thymocytes. Immunity 2000;13:73–84.[CrossRef][Medline]

46. Kiel MJ, Yilmaz OH, Iwashita T et al. SLAM family receptors distinguish hematopoietic stem and progenitor cells and reveal endothelial niches for stem cells. Cell 2005;121:1109–1121.[CrossRef][Medline]

This Article Abstract Full Text (PDF) Supplemental Data All Versions of this Article: 2007-0428v1 26/3/621    most recent Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints/Permissions Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Lahmar, M. Articles by Lauret, E. Search for Related Content PubMed PubMed Citation Articles by Lahmar, M. Articles by Lauret, E.