|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
CANCER STEM CELLS |
Max Planck Institute for Molecular Biomedicine, Münster, Germany
Key Words. OCT4 • Stem cells • Tumor cell lines • HeLa cells • MCF7 cells
Correspondence: Correspondence: Hans R. Schöler, Ph.D., Max Planck Institute for Molecular Biomedicine, Department of Cell and Developmental Biology, Röntgenstraβe 20, D-48149 Münster, Germany. Telephone: +49-251-70635-300; Fax: +49-251-70365-399; e-mail: office{at}mpi-muenster.mpg.de
Received on August 9, 2007;
accepted for publication on November 13, 2007.
First published online in STEM CELLS EXPRESS November 21, 2007.
| ABSTRACT |
|---|
|
|
|---|
Disclosure of potential conflicts of interest is found at the end of this article.
| INTRODUCTION |
|---|
|
|
|---|
Ectopic OCT4 expression in somatic (stem) cells causes epithelial dysplasia and may be associated with tumor formation, as reported by Hochedlinger [6]. Several recently published studies describe the presence of OCT4 protein in tumor tissues or cells, such as bladder cancer [7], breast cancer [8–11], pancreatic cancer [12], as well as osteo- and chondrosarcoma [13]. Tai et al. [9] demonstrated the presence of OCT4 in several cell lines from breast, pancreatic, liver, kidney, and gastric cancer as well as in the cervical carcinoma cell line HeLa and the breast cancer cell line MCF7 by immunofluorescence analyses. In a recent publication, Zangrossi et al. [14] made reference to these results and, in particular, to the detection of OCT4 expression in MCF7 cells, which was described as a positive control. In these recent studies, OCT4 fluorescence signal was not localized to the nucleus, but to the cytosol. These findings are not consistent with earlier studies, which did not report OCT4 expression in HeLa cells, 293 kidney cancer cells, and COS cells—which had not been transfected with an OCT4 construct—by gel shift assay (EMSA), Western blot, or immunofluorescence [15–19]. In line with these contradictory results, three recent papers dispute the role of OCT4 as a valid marker for stemness. Liedtke et al. raise the issue of OCT4 pseudogenes as a source of confusion in stem cell research [20] and Kotoula et al. demonstrate that the second isoform of hOCT4, that is, hOCT4B, which is related neither to stemness nor pluripotency, can account for much of the misinterpretation of experimental data [21]. In addition, Lengner et al. demonstrated that the absence of OCT4 protein does not interfere with somatic stem cell self-renewal [22].
To address these contradictory results as well as potential pitfalls regarding OCT4 as a general cancer stem cell marker, we systematically determined OCT4 expression in HeLa and MCF7 cells in comparison with the human teratoma cell line nTera using immunofluorescence, Western blot, RT-PCR, and DNA methylation analyses.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Generation of the Monoclonal Antibody GA1
Six-week-old female Balb/c mice were immunized with 20 µg of recombinant mouse OCT4 protein diluted in Gerbu adjuvant (GA; Gerbu, Gaiberg, Germany, http://www.gerbu.de) per injection according to the manufacturer's specifications. Spleen cells from mice with sufficient serum titer (>1:1000 in a standard ELISA using 100 µg OCT4 protein per plate) were fused with myeloma cells according to standard procedures. Positive clones were recloned three times by limiting dilution. Clone GA1 was specifically reactive, and its supernatant was subjected to purification by protein G chromatography for immunofluorescence analyses.
Immunofluorescence
HeLa, MCF7, and nTera cells grown on chamber slides were washed in PBS before being fixed in 100% methanol (Sigma, Munich, Germany, http://www.sigmaaldrich.com) for 7 min at –20°C and then rinsed in acetone (Sigma, Germany) for 20-second at –20°C. Alternatively, cells were fixed in 4% paraformaldehyde for 5 min and then permeabilized in 0.1% Tween 20 in PBS (PBS-Tween) for additional 5 min. The cells were washed three times in PBS before being incubated with anti-OCT4 monoclonal antibodies for 45 min at room temperature. Several antibody dilutions were tested, with the 1:100 dilution considered optimal for both antibodies: sc5279 (Santa Cruz Biotechnology, Santa Cruz, CA, http://www.scbt.com) and purified GA1 (1 mg/ml). For negative control samples, the primary antibody was either omitted or the sc5279 antibody was blocked by inhibition with a four-fold excess of OCT4 blocking peptide (sc4420, Santa Cruz Biotechnology). Cells were washed three times in PBS both before and after incubation with the secondary antibody (Cy3-labeled goat anti-mouse lgG, Jackson ImmunoResearch, West Grove, PA, http://www.jacksonimmuno.com) and 1 nM 4',6-Diamidino-2-Phenyl-Indol-dihydrochloride (DAPI, Sigma). ProLong Gold and SlowFade Gold Antifade Reagent (Invitrogen, Germany) was used as mounting medium to minimize fluorochrome quenching.
Western Blot
HeLa, MCF7, and nTera cells were cultured on 10-cm tissue culture dishes until the growth reached confluence. Cell extracts were prepared by hypotonic lysis in 1 ml of 10 mM Tris/HCl pH 7.4, supplemented with protease inhibitors (100 µM phenylmethanesulfonyl fluoride, PMSF; 1 µM leupeptin; 1 µM pepstatin; 0.3 µM aprotinin; all Sigma, Germany), followed by ultrasound homogenization for six cycles (5 seconds each). Protein concentrations were determined using the BIO-Rad Protein Assay (Biorad, Germany). Samples were separated on a 10% SDS-polyacrylamide gel (PAGE) according to standard procedures and blotted onto a PVDF membrane (Millipore, Schwalbach, Germany, http://www.millipore.de). After blocking in 3% milk powder (Amersham, Freiberg, Germany, http://www.gelifescience.com) and washing in PBS-Tween, the blots were incubated with anti-OCT4 monoclonal antibody (sc5279, Santa Cruz Biotechnology: 1:1000 or undiluted GA1 supernatant). Horseradish peroxidase–coupled anti-mouse IgG antibody (1:10,000, Amersham, Germany) was used as the secondary antibody. For chemoluminescence detection, ECL (ECL Western blotting detection reagents and analysis system, Amersham, Germany) was applied to the blots according the manufacturer's instructions.
RNA Isolation and RT-PCR
Confluent 10-cm culture plates of HeLa, MCF7, and nTera cells were used for RNA isolation (RNeasy Mini Kit, Qiagen, Hilden, Germany, http://www1.qiagen.com). RNA quality and quantity were determined using the 2,100 Bioanalyzer system (RNA 6,000 Nano Assay, Agilent Technologies, Germany). Four.2 µg of total RNA was digested with DNAse I (Invitrogen) and used for first strand cDNA synthesis (Super Script III First-Strand Synthesis System, Invitrogen). Both the HeLa mRNA sample that came with this kit and our freshly isolated total RNA sample from HeLa cells served as positive controls. Optimal RT-PCR reaction conditions were set as: 35 cycles of 94°C for 30 seconds; 58°C for 30 seconds; 72°C for 45 seconds, after an initial denaturation step of 94°C for 10 min. PCR products were sequenced to ensure specific amplification. For detection of human OCT4 RNA, the primer combination used was ACACCTGGCTTCGGATTTCG (for) and GGCGATGTGGCTGATCTGCT (rev) [23], and for detection of human β-actin RNA, the primer combination used was CGTGGGGCGCCCCAGGCACCA (for) and TTGGCCTTGGGGTTCAGGGGGG (rev).
Quantitative RT-PCR
For real-time RT-PCR analyses, OCT4 transcript levels were determined using the ABI PRISM Sequence Detection System 7,900HT (Applied Biosystems, Foster City, CA, http://www.appliedbiosystems.com) and the ready-to-use 5'-Nuclease Assays-on-Demand (POU5F1A: Hs01895061_u1 and Hs03005111_g1, POU5F1B: Hs00742896_s1, β-actin (ACTB: Hs99999903_m1). Raw quantities of OCT4 transcripts were normalized to the endogenous β-actin gene within the log-linear phase of the amplification curve (Ct method, ABI PRISM 7,700 Sequence Detection System User Bulletin 2; Applied Biosystems). Three replicates were used for each real-time PCR; an RT blank and a no-template blank served as negative controls.
Bisulfite Sequencing Analysis
To determine the methylation status of the OCT4 distal enhancer (DE) region, which is highly conserved among species and one of the important regulatory elements of OCT4 [24], bisulfite sequencing PCR (BS-PCR) was performed with genomic DNA from HeLA, MCF7, and nTera cells as published earlier [25]. All PCR amplifications included a total of 50 cycles of denaturation at 94°C for 30 seconds, annealing at proper temperature for each target region for 30 seconds, and extension at 72°C for 30 seconds with a first denaturation at 94°C for 5 min and final extension at 72°C for 10 min. The primers and annealing temperatures were as follows: OCT4 distal enhancer (DE) first sense 5-AGGAGTTATTAGGAAAATGGGTAGTAG-3, OCT4 DE first antisense 5-TACCTTCTAAAAAAATAAATATCCC-3 (537 base pairs [bp], 45°C); OCT4 DE second sense 5-ATTTGTTTTTTGGGTAGTTAAAGGT-3, OCT4 DE second antisense 5-CCAACTATCTTCATCTTAATAACATCC-3 (221 bp, 55°C). Three µl of each of the first PCR product was used as the template for the second PCR reaction. The second PCR products were subcloned using PCR 2.1-TOPO vector (Invitrogen) according to the manufacturer's protocol. The reconstructed plasmids were purified with QIAprep Spin Miniprep kit (Qiagen), and individual clones were subsequently sequenced (GATC Biotech, Konstanz, Germany, http://www.gatc-biochem.com). Clones were only accepted if there was at least 90% cytosine conversion, and all possible clonalities were excluded based on criteria from the BiQ Analyzer software (Max Planck Society, München, Germany, http://www.mpg.de). At least 10 replicates were performed for each of the selected regions in each cell line.
| RESULTS |
|---|
|
|
|---|
-curve was modified to further enhance these fluorescence signals, as demonstrated in the lower right insets in Figure 1E, 1G, 1I, 1K. However, similar results were obtained for the negative controls (no-first-antibody controls or after inhibition of the sc5279-immunoreactivity with the OCT4-blocking peptide), most likely due to background staining of the secondary antibody (supplemental online Fig. 1).
|
50 kDa) were detected in the positive control nTera samples using both anti-OCT4 antibodies (sc5279 in Fig. 2A and GA1 in Fig. 2B), but only very faint, if any, bands in the expected size range and some bands of smaller size were detected using HeLa and MCF7 extracts. To determine if any of these bands are specific to OCT4, we addressed the issue of nonspecific reactivity of the secondary antibody (Fig. 2C, 2D). One blot was incubated with the sc5279 antibody (Fig. 2C) and another was used as no-first-antibody negative control (Fig. 2D); both blots incubated with the same secondary antibody. Again, faint bands were detected in the HeLa and MCF7 preparations (dashed box in Fig. 2C), but overexposure of the no-first-antibody negative control blot clearly demonstrated a nonspecific signal in the corresponding region due to binding of the secondary antibody. Furthermore, in the samples incubated with the secondary antibody alone, we also detected the smaller-size bands (Fig. 2C, 2D).
|
|
| DISCUSSION |
|---|
|
|
|---|
In our present study, we used two anti-OCT4 monoclonal antibodies to address the reported inconsistency of OCT4 expression in tumor cell lines: a commercial antibody from Santa Cruz Biotechnology (sc5279) and purified hybridoma supernatant (GA1) prepared in our laboratory. The human teratoma cell line nTera was readily available and used as a positive control for OCT4 expression in all experiments. Carefully selected negative controls obtained without the inclusion of the primary antibody or by pre-incubation of the primary antibodies with the respective blocking peptide, clearly demonstrated that the faint fluorescence signals detected in HeLa and MCF7 cells are due to nonspecific reactions of the secondary antibody (Fig. 1). Observations of cytosolic staining similar to those recently reported by Zangrossi et al. [14] and Tai et al. [9] (dashed boxes in Fig. 1E, 1G, 1I, 1K) could only be obtained when the microscope settings were drastically manipulated to detect even the background fluorescence and when the images were processed with the help of
-curve, brightness, and contrast settings. With these settings, background fluorescence signals were also obtained in negative controls—one which included a blocking peptide for the OCT4 antibody (data not shown) or the other which omitted the primary antibody (online supplemental Fig. 1). Our Western blot analyses (Fig. 2) confirmed the absence of OCT4 protein in extracts from HeLa and MCF7 cells. However, faint signals in the expected size range were obtained for samples in which the primary antibody was omitted, due to nonspecific binding of the secondary antibody to the whole cell lysate. Again, we emphasize the need to perform this appropriate control or to select a monoclonal antibody that can be blocked with the respective blocking peptide, the latter being the most favorable control.
In our present study, we could not detect OCT4 transcripts in HeLa or MCF7 cells by RT-PCR analysis (Fig. 3A). False-positive results may however be reported, as RT-PCR data may be readily misinterpreted due to the existence of many OCT4 pseudogenes and their presence in several tissues [26]. For example, processed OCT4 pseudogenes are present in the genomic DNA and can be amplified and detected by PCR (if the sample is not digested with DNAse), even in the –RT control, in which the reverse transcriptase reaction is omitted. This type of misinterpretation may have occurred in the work of Zangrossi et al. who reported the presence of a PCR signal even in the RT controls [14]. Due to this inconsistency, the authors also performed quantitative RT-PCR for human OCT4 and demonstrated a 25-fold lower expression in peripheral blood mononuclear cells than in human embryonic stem cells, which were used as a positive control. However, the Applied Biosystems assay used in their study does not amplify the pluripotency-related isoform OCT4A but does amplify the OCT4B isoform, whose function remains unresolved. The alternative inventoried assay, which is based on the OCT4A sequence, also amplifies the OCT4 pseudogene 3. Therefore, we analyzed the made-to-order assay Hs03005111_g1, which clearly detects OCT4A in nTera cells. With this assay, CT-values close to the detection limit (<3 cycles) were obtained using HeLa- and MCF-RNA preparations, suggesting a basal promoter activity, at most, in these two cell lines (Fig. 3B). Last, but not least, we determined the methylation status of the distal enhancer region of the OCT4 promoter by bisulfite sequencing analysis and clearly demonstrated hypermethylation of this region in HeLa and MCF7 cells compared to hypomethylation in nTera cells (Fig. 3C).
In conclusion, we clearly demonstrate the absence of OCT4 expression—that is, the absence of both RNA and protein signals—in HeLa and MCF7 cells, and the strong OCT4 expression in the positive control nTera cells. The use of carefully selected negative controls—such as those obtained by using specific monoclonal antibodies or blocking peptide for immunofluorescence or Western blots—as well as the exclusion of OCT4 pseudogenes and the OCT4B isoform as a confounding source of PCR signal must be considered in investigations of OCT4 expression in tumor and somatic stem cells. The most appropriate control, however, is to determine the methylation status of the OCT4 promoter region in cells that are expected to express OCT4.
| DISCLOSURE OF POTENTIAL CONFLICTS OF INTEREST |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
|
|
|---|
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
C. R. Jeter, M. Badeaux, G. Choy, D. Chandra, L. Patrawala, C. Liu, T. Calhoun-Davis, H. Zaehres, G. Q. Daley, and D. G. Tang Functional Evidence that the Self-Renewal Gene NANOG Regulates Human Tumor Development Stem Cells, May 1, 2009; 27(5): 993 - 1005. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. WANG, W. HE, C. LU, Z. WANG, J. WANG, K. E. GIERCKSKY, J. M. NESLAND, and Z. SUO Oct3/4 and Sox2 Are Significantly Associated with an Unfavorable Clinical Outcome in Human Esophageal Squamous Cell Carcinoma Anticancer Res, April 1, 2009; 29(4): 1233 - 1241. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Trosko REVIEW PAPER: Cancer Stem Cells and Cancer Nonstem Cells: From Adult Stem Cells or from Reprogramming of Differentiated Somatic Cells Vet. Pathol., March 1, 2009; 46(2): 176 - 193. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Atlasi, S. J. Mowla, S. A.M. Ziaee, P. J. Gokhale, and P. W. Andrews OCT4 Spliced Variants Are Differentially Expressed in Human Pluripotent and Nonpluripotent Cells Stem Cells, December 1, 2008; 26(12): 3068 - 3074. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Mizuno and M. Kosaka Novel Variants of Oct-3/4 Gene Expressed in Mouse Somatic Cells J. Biol. Chem., November 7, 2008; 283(45): 30997 - 31004. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Kaltz, A. Funari, S. Hippauf, B. Delorme, D. Noel, M. Riminucci, V. R. Jacobs, T. Haupl, C. Jorgensen, P. Charbord, et al. In Vivo Osteoprogenitor Potency of Human Stromal Cells from Different Tissues Does Not Correlate with Expression of POU5F1 or Its Pseudogenes Stem Cells, September 1, 2008; 26(9): 2419 - 2424. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Monk, M. Hitchins, and S. Hawes Differential expression of the embryo/cancer gene ECSA(DPPA2), the cancer/testis gene BORIS and the pluripotency structural gene OCT4, in human preimplantation development Mol. Hum. Reprod., June 1, 2008; 14(6): 347 - 355. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| STEM CELLS | THE ONCOLOGIST | CME | ALPHAMED PRESS JOURNALS |