HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Supplemental Data All Versions of this Article: 2007-0657v1 26/3/692    most recent Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints/Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Cantz, T. Articles by Schöler, H. R. Search for Related Content PubMed PubMed Citation Articles by Cantz, T. Articles by Schöler, H. R.

CANCER STEM CELLS

Absence of OCT4 Expression in Somatic Tumor Cell Lines

Max Planck Institute for Molecular Biomedicine, Münster, Germany

Key Words. OCT4 • Stem cells • Tumor cell lines • HeLa cells • MCF7 cells

Correspondence: Correspondence: Hans R. Schöler, Ph.D., Max Planck Institute for Molecular Biomedicine, Department of Cell and Developmental Biology, Röntgenstraβe 20, D-48149 Münster, Germany. Telephone: +49-251-70635-300; Fax: +49-251-70365-399; e-mail: office{at}mpi-muenster.mpg.de

Received on August 9, 2007; accepted for publication on November 13, 2007.

First published online in STEM CELLS EXPRESS  November 21, 2007.

	ABSTRACT

Top Abstract Introduction Materials and Methods Results Discussion Disclosure of Potential... Acknowledgments References

 
The POU-domain transcription factor OCT4 is associated with the pluripotent state of cells comprising the inner cell mass of pre-implantation embryos and has been known to play a critical role in the maintenance of pluripotency of embryonic stem cells. Reactivation of OCT4 expression is postulated to occur in differentiated cells that have undergone carcinogenesis, or tumor formation. In contrast to earlier studies, recent reports describe OCT4 expression in several human tumor cell lines. To resolve the apparent discrepancy in OCT4 expression between earlier and recent studies, we determined OCT4 expression in the cervical carcinoma cell line HeLa and the breast cancer cell line MCF7 in comparison with the human teratoma cell line nTera by immunofluorescence, Western blot, and RT-PCR analyses. We were unable to detect staining of the OCT4 transcription factor in the nucleus of HeLa and MCF7 cells by immunofluorescence using two different monoclonal antibodies. Faint cytoplasmic staining in HeLa and MCF7 cells was observed; however, no OCT4 signal could be detected by Western blot analysis. In addition, we were unable to detect significant levels of OCT4 mRNA in HeLa and in MCF7 cells by RT-PCR. Furthermore, the OCT4 promoter region is highly methylated in HeLa and MCF7 cells. We argue that recent reports of OCT4 expression in these and other cancer cell lines could actually be attributed to OCT4 pseudogene expression or misinterpretation of background signals in immunofluorescence experiments. In conclusion, we emphasize the need for adequate controls in investigations of OCT4 expression in somatic cell lines by immunofluorescence and RT-PCR.

Disclosure of potential conflicts of interest is found at the end of this article.

	INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion Disclosure of Potential... Acknowledgments References

 
The POU-domain transcription factor OCT4 is known to play a crucial role in the maintenance of embryonic stem cell potency and in the propagation of the mammalian germline [1, 2]. Loss of OCT4 expression at the blastocyst stage, by in vivo mutagenesis, has been shown to lead to differentiation of the cells of the inner cell mass into the trophectodermal cell fate [3], thereby suggesting that OCT4 is an essential component in the establishment and/or maintenance of cellular pluripotency. Following gastrulation, OCT4 is involved in the maintenance of the mammalian germline. Recent studies have demonstrated that OCT4 is required for the survival of early primordial germ cells, as these cells undergo apoptosis after deletion of the Oct4 locus in a conditional knock-out mouse model [4]. OCT4 is expressed in germ cell tumors, such as seminoma, dysgerminoma, germinoma, and embryonic carcinoma, and can be detected by immunohistochemistry, a tool that holds immense diagnostic potential in these diseases, according to a recent review by Cheng [5].

Ectopic OCT4 expression in somatic (stem) cells causes epithelial dysplasia and may be associated with tumor formation, as reported by Hochedlinger [6]. Several recently published studies describe the presence of OCT4 protein in tumor tissues or cells, such as bladder cancer [7], breast cancer [8–11], pancreatic cancer [12], as well as osteo- and chondrosarcoma [13]. Tai et al. [9] demonstrated the presence of OCT4 in several cell lines from breast, pancreatic, liver, kidney, and gastric cancer as well as in the cervical carcinoma cell line HeLa and the breast cancer cell line MCF7 by immunofluorescence analyses. In a recent publication, Zangrossi et al. [14] made reference to these results and, in particular, to the detection of OCT4 expression in MCF7 cells, which was described as a positive control. In these recent studies, OCT4 fluorescence signal was not localized to the nucleus, but to the cytosol. These findings are not consistent with earlier studies, which did not report OCT4 expression in HeLa cells, 293 kidney cancer cells, and COS cells—which had not been transfected with an OCT4 construct—by gel shift assay (EMSA), Western blot, or immunofluorescence [15–19]. In line with these contradictory results, three recent papers dispute the role of OCT4 as a valid marker for stemness. Liedtke et al. raise the issue of OCT4 pseudogenes as a source of confusion in stem cell research [20] and Kotoula et al. demonstrate that the second isoform of hOCT4, that is, hOCT4B, which is related neither to stemness nor pluripotency, can account for much of the misinterpretation of experimental data [21]. In addition, Lengner et al. demonstrated that the absence of OCT4 protein does not interfere with somatic stem cell self-renewal [22].

To address these contradictory results as well as potential pitfalls regarding OCT4 as a general cancer stem cell marker, we systematically determined OCT4 expression in HeLa and MCF7 cells in comparison with the human teratoma cell line nTera using immunofluorescence, Western blot, RT-PCR, and DNA methylation analyses.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion Disclosure of Potential... Acknowledgments References

 
Cell Culture
HeLa and MCF7 cells were newly obtained from the European Collection of Cell Culture (London, http://www.ecacc.org.uk) for this study (Lot numbers 04A020 and 02K001, respectively) and cultured on gelatin-coated (0.1%) tissue culture plates (Falcon BD, Heidelberg, Germany, http://catalog.bd.com) in MEM-Earls medium (Invitrogen, Karlsruhe, Germany, http://www.invitrogen.com), supplemented with 10% heat-inactivated fetal calf serum and the additives L-Glutamine (2 mM), non-essential amino acids, and penicillin/streptomycin (all Invitrogen). nTera cells (ECACC: Lot number 02L006), which were used as a positive control for OCT4 expression, were cultured on tissue culture plates in high glucose DMEM (Invitrogen), supplemented with 10% heat-inactivated fetal calf serum, L-Glutamine (2 mM), and penicillin/streptomycin. To ensure identical incubation conditions during immunofluorescence analyses, HeLa, MCF7, and nTera cells were cultured side-by-side, in one well each, in 4-well chamber slides (Nunc).

Generation of the Monoclonal Antibody GA1
Six-week-old female Balb/c mice were immunized with 20 µg of recombinant mouse OCT4 protein diluted in Gerbu adjuvant (GA; Gerbu, Gaiberg, Germany, http://www.gerbu.de) per injection according to the manufacturer's specifications. Spleen cells from mice with sufficient serum titer (>1:1000 in a standard ELISA using 100 µg OCT4 protein per plate) were fused with myeloma cells according to standard procedures. Positive clones were recloned three times by limiting dilution. Clone GA1 was specifically reactive, and its supernatant was subjected to purification by protein G chromatography for immunofluorescence analyses.

Immunofluorescence
HeLa, MCF7, and nTera cells grown on chamber slides were washed in PBS before being fixed in 100% methanol (Sigma, Munich, Germany, http://www.sigmaaldrich.com) for 7 min at –20°C and then rinsed in acetone (Sigma, Germany) for 20-second at –20°C. Alternatively, cells were fixed in 4% paraformaldehyde for 5 min and then permeabilized in 0.1% Tween 20 in PBS (PBS-Tween) for additional 5 min. The cells were washed three times in PBS before being incubated with anti-OCT4 monoclonal antibodies for 45 min at room temperature. Several antibody dilutions were tested, with the 1:100 dilution considered optimal for both antibodies: sc5279 (Santa Cruz Biotechnology, Santa Cruz, CA, http://www.scbt.com) and purified GA1 (1 mg/ml). For negative control samples, the primary antibody was either omitted or the sc5279 antibody was blocked by inhibition with a four-fold excess of OCT4 blocking peptide (sc4420, Santa Cruz Biotechnology). Cells were washed three times in PBS both before and after incubation with the secondary antibody (Cy3-labeled goat anti-mouse lgG, Jackson ImmunoResearch, West Grove, PA, http://www.jacksonimmuno.com) and 1 nM 4',6-Diamidino-2-Phenyl-Indol-dihydrochloride (DAPI, Sigma). ProLong Gold and SlowFade Gold Antifade Reagent (Invitrogen, Germany) was used as mounting medium to minimize fluorochrome quenching.

Western Blot
HeLa, MCF7, and nTera cells were cultured on 10-cm tissue culture dishes until the growth reached confluence. Cell extracts were prepared by hypotonic lysis in 1 ml of 10 mM Tris/HCl pH 7.4, supplemented with protease inhibitors (100 µM phenylmethanesulfonyl fluoride, PMSF; 1 µM leupeptin; 1 µM pepstatin; 0.3 µM aprotinin; all Sigma, Germany), followed by ultrasound homogenization for six cycles (5 seconds each). Protein concentrations were determined using the BIO-Rad Protein Assay (Biorad, Germany). Samples were separated on a 10% SDS-polyacrylamide gel (PAGE) according to standard procedures and blotted onto a PVDF membrane (Millipore, Schwalbach, Germany, http://www.millipore.de). After blocking in 3% milk powder (Amersham, Freiberg, Germany, http://www.gelifescience.com) and washing in PBS-Tween, the blots were incubated with anti-OCT4 monoclonal antibody (sc5279, Santa Cruz Biotechnology: 1:1000 or undiluted GA1 supernatant). Horseradish peroxidase–coupled anti-mouse IgG antibody (1:10,000, Amersham, Germany) was used as the secondary antibody. For chemoluminescence detection, ECL (ECL Western blotting detection reagents and analysis system, Amersham, Germany) was applied to the blots according the manufacturer's instructions.

RNA Isolation and RT-PCR
Confluent 10-cm culture plates of HeLa, MCF7, and nTera cells were used for RNA isolation (RNeasy Mini Kit, Qiagen, Hilden, Germany, http://www1.qiagen.com). RNA quality and quantity were determined using the 2,100 Bioanalyzer system (RNA 6,000 Nano Assay, Agilent Technologies, Germany). Four.2 µg of total RNA was digested with DNAse I (Invitrogen) and used for first strand cDNA synthesis (Super Script III First-Strand Synthesis System, Invitrogen). Both the HeLa mRNA sample that came with this kit and our freshly isolated total RNA sample from HeLa cells served as positive controls. Optimal RT-PCR reaction conditions were set as: 35 cycles of 94°C for 30 seconds; 58°C for 30 seconds; 72°C for 45 seconds, after an initial denaturation step of 94°C for 10 min. PCR products were sequenced to ensure specific amplification. For detection of human OCT4 RNA, the primer combination used was ACACCTGGCTTCGGATTTCG (for) and GGCGATGTGGCTGATCTGCT (rev) [23], and for detection of human β-actin RNA, the primer combination used was CGTGGGGCGCCCCAGGCACCA (for) and TTGGCCTTGGGGTTCAGGGGGG (rev).

Quantitative RT-PCR
For real-time RT-PCR analyses, OCT4 transcript levels were determined using the ABI PRISM Sequence Detection System 7,900HT (Applied Biosystems, Foster City, CA, http://www.appliedbiosystems.com) and the ready-to-use 5'-Nuclease Assays-on-Demand (POU5F1A: Hs01895061_u1 and Hs03005111_g1, POU5F1B: Hs00742896_s1, β-actin (ACTB: Hs99999903_m1). Raw quantities of OCT4 transcripts were normalized to the endogenous β-actin gene within the log-linear phase of the amplification curve (Ct method, ABI PRISM 7,700 Sequence Detection System User Bulletin 2; Applied Biosystems). Three replicates were used for each real-time PCR; an RT blank and a no-template blank served as negative controls.

Bisulfite Sequencing Analysis
To determine the methylation status of the OCT4 distal enhancer (DE) region, which is highly conserved among species and one of the important regulatory elements of OCT4 [24], bisulfite sequencing PCR (BS-PCR) was performed with genomic DNA from HeLA, MCF7, and nTera cells as published earlier [25]. All PCR amplifications included a total of 50 cycles of denaturation at 94°C for 30 seconds, annealing at proper temperature for each target region for 30 seconds, and extension at 72°C for 30 seconds with a first denaturation at 94°C for 5 min and final extension at 72°C for 10 min. The primers and annealing temperatures were as follows: OCT4 distal enhancer (DE) first sense 5-AGGAGTTATTAGGAAAATGGGTAGTAG-3, OCT4 DE first antisense 5-TACCTTCTAAAAAAATAAATATCCC-3 (537 base pairs [bp], 45°C); OCT4 DE second sense 5-ATTTGTTTTTTGGGTAGTTAAAGGT-3, OCT4 DE second antisense 5-CCAACTATCTTCATCTTAATAACATCC-3 (221 bp, 55°C). Three µl of each of the first PCR product was used as the template for the second PCR reaction. The second PCR products were subcloned using PCR 2.1-TOPO vector (Invitrogen) according to the manufacturer's protocol. The reconstructed plasmids were purified with QIAprep Spin Miniprep kit (Qiagen), and individual clones were subsequently sequenced (GATC Biotech, Konstanz, Germany, http://www.gatc-biochem.com). Clones were only accepted if there was at least 90% cytosine conversion, and all possible clonalities were excluded based on criteria from the BiQ Analyzer software (Max Planck Society, München, Germany, http://www.mpg.de). At least 10 replicates were performed for each of the selected regions in each cell line.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion Disclosure of Potential... Acknowledgments References

 
We first analyzed the expression of OCT4 in HeLa and MCF7 cells in comparison with human teratoma cells (nTera) by immunofluorescence (Fig. 1), as this method provides information on both the presence and location of the OCT4 protein. Two different fixatives (methanol/acetone or paraformaldehyde followed by cell permeabilization with PBS-Tween) were used to optimize the immunofluorescence protocol. Both fixatives yielded comparable results, but the methanol/acetone fixative resulted in slightly lower background fluorescence. To ensure identical antibody incubation conditions for all three cell lines, HeLa and MCF7 cells were cultured on the same 4-well chamber slide as were the nTera cells, which served as the positive control. OCT4 was strongly detected in the nucleus of nTera cells using two different monoclonal anti-OCT4 antibodies (sc5279 in Fig. 1A and GA1 in Fig. 1C). When we controlled for the microscope settings (i.e., same exposure time, camera gain, etc.), no specific signal could be detected in HeLa and MCF7 cells neither using the sc5279 antibody nor the GA1-antibody (Fig. 1E, 1G, 1I, 1K). Upon a five-fold increase in exposure time and a higher camera gain setting, fluorescence signals could be detected in the cytosol of HeLa and MCF7 samples. During image processing (Adobe Photoshop CS1), the -curve was modified to further enhance these fluorescence signals, as demonstrated in the lower right insets in Figure 1E, 1G, 1I, 1K. However, similar results were obtained for the negative controls (no-first-antibody controls or after inhibition of the sc5279-immunoreactivity with the OCT4-blocking peptide), most likely due to background staining of the secondary antibody (supplemental online Fig. 1).

View larger version (48K): [in this window] [in a new window]   Figure 1. OCT4 immunofluorescence in tumor cell lines. nTera (A–D), HeLa (E–H), and MCF7 (I–L) cells were grown in separate wells of 4-well chamber slides to ensure identical sample processing. Both anti-OCT4 monoclonal antibodies (sc5279 and GA1) yielded strong nuclear staining signals in nTera cells (A, C), which co-localized to the DAPI-staining (B, D). In contrast, with the same settings, no significant signals were detected in HeLa (E, G) or MCF7 (I, K) cells. Overexposure and excessive manipulations of signal levels and -curve adaptations during image processing only led to the amplification of background fluorescence (lower right quadrants in E, G, I, K) due to nonspecific cytosolic antibody binding (scale bar: 50 µm).

View larger version (102K): [in this window] [in a new window]   Figure 2. Western blot analyses of nTera, HeLa, and MCF7 cell protein extracts. Two independent protein preparations were analyzed on one SDS-PAGE (left and right of dashed line in A and B, respectively) and detected on separate gels using two anti-OCT4 monoclonal antibodies (sc5279 in A, GA1 in B). In nTera extracts, the 50 kDa OCT4 protein was consistently detected, but only faint bands, if any, were detected in the HeLa and MCF7 extracts. In these samples, additional strong bands were also detected, corresponding to smaller-size proteins. In a third experiment, another protein preparation was loaded onto two SDS-PAGE, and the blots were incubated with sc5279 (C) or without a primary antibody as a negative control (D). Faint bands were detected for HeLa and MCF7 cells using the sc5279 antibody (dashed box in C), but overexposure of the negative-control blot clearly demonstrated that these bands were false positives due to nonspecific binding of the secondary antibody.

View larger version (35K): [in this window] [in a new window]   Figure 3. Gene expression analyses of nTera, HeLa, and MCF7 cells. Equal amounts of total RNA were first transcribed into cDNA, and OCT4 and β-actin loci were then amplified by RT-PCR (A). Strong signals were obtained using nTera RNA preparations, but no OCT4 PCR product was obtained using HeLa RNA, regardless of whether we used the control sample from a commercial cDNA synthesis kit or freshly isolated RNA prepared from HeLa cells in our laboratory. Furthermore, no OCT4 PCR product was obtained using the MCF7 RNA preparations. In addition, by quantitative real-time RT-PCR (B) specific for human OCT4A (black bars), only basal OCT4 expression in HeLa and MCF7 cells was demonstrated. Using another assay, which can also detect the OCT4 pseudogene three (white bars), slightly stronger OCT4 expression was obtained. OCT4B transcription (gray bars) was similar in all samples. Most strikingly, determination of the methylation status of the distal enhancer region of the OCT4 promoter showed almost fully methylated CpG islets in HeLa and MCF7 in contrast to completely unmethylated regions in nTera cells (C).

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion Disclosure of Potential... Acknowledgments References

In our present study, we used two anti-OCT4 monoclonal antibodies to address the reported inconsistency of OCT4 expression in tumor cell lines: a commercial antibody from Santa Cruz Biotechnology (sc5279) and purified hybridoma supernatant (GA1) prepared in our laboratory. The human teratoma cell line nTera was readily available and used as a positive control for OCT4 expression in all experiments. Carefully selected negative controls obtained without the inclusion of the primary antibody or by pre-incubation of the primary antibodies with the respective blocking peptide, clearly demonstrated that the faint fluorescence signals detected in HeLa and MCF7 cells are due to nonspecific reactions of the secondary antibody (Fig. 1). Observations of cytosolic staining similar to those recently reported by Zangrossi et al. [14] and Tai et al. [9] (dashed boxes in Fig. 1E, 1G, 1I, 1K) could only be obtained when the microscope settings were drastically manipulated to detect even the background fluorescence and when the images were processed with the help of -curve, brightness, and contrast settings. With these settings, background fluorescence signals were also obtained in negative controls—one which included a blocking peptide for the OCT4 antibody (data not shown) or the other which omitted the primary antibody (online supplemental Fig. 1). Our Western blot analyses (Fig. 2) confirmed the absence of OCT4 protein in extracts from HeLa and MCF7 cells. However, faint signals in the expected size range were obtained for samples in which the primary antibody was omitted, due to nonspecific binding of the secondary antibody to the whole cell lysate. Again, we emphasize the need to perform this appropriate control or to select a monoclonal antibody that can be blocked with the respective blocking peptide, the latter being the most favorable control.

In our present study, we could not detect OCT4 transcripts in HeLa or MCF7 cells by RT-PCR analysis (Fig. 3A). False-positive results may however be reported, as RT-PCR data may be readily misinterpreted due to the existence of many OCT4 pseudogenes and their presence in several tissues [26]. For example, processed OCT4 pseudogenes are present in the genomic DNA and can be amplified and detected by PCR (if the sample is not digested with DNAse), even in the –RT control, in which the reverse transcriptase reaction is omitted. This type of misinterpretation may have occurred in the work of Zangrossi et al. who reported the presence of a PCR signal even in the RT controls [14]. Due to this inconsistency, the authors also performed quantitative RT-PCR for human OCT4 and demonstrated a 25-fold lower expression in peripheral blood mononuclear cells than in human embryonic stem cells, which were used as a positive control. However, the Applied Biosystems assay used in their study does not amplify the pluripotency-related isoform OCT4A but does amplify the OCT4B isoform, whose function remains unresolved. The alternative inventoried assay, which is based on the OCT4A sequence, also amplifies the OCT4 pseudogene 3. Therefore, we analyzed the made-to-order assay Hs03005111_g1, which clearly detects OCT4A in nTera cells. With this assay, C_T-values close to the detection limit (<3 cycles) were obtained using HeLa- and MCF-RNA preparations, suggesting a basal promoter activity, at most, in these two cell lines (Fig. 3B). Last, but not least, we determined the methylation status of the distal enhancer region of the OCT4 promoter by bisulfite sequencing analysis and clearly demonstrated hypermethylation of this region in HeLa and MCF7 cells compared to hypomethylation in nTera cells (Fig. 3C).

In conclusion, we clearly demonstrate the absence of OCT4 expression—that is, the absence of both RNA and protein signals—in HeLa and MCF7 cells, and the strong OCT4 expression in the positive control nTera cells. The use of carefully selected negative controls—such as those obtained by using specific monoclonal antibodies or blocking peptide for immunofluorescence or Western blots—as well as the exclusion of OCT4 pseudogenes and the OCT4B isoform as a confounding source of PCR signal must be considered in investigations of OCT4 expression in tumor and somatic stem cells. The most appropriate control, however, is to determine the methylation status of the OCT4 promoter region in cells that are expected to express OCT4.

	DISCLOSURE OF POTENTIAL CONFLICTS OF INTEREST

Top Abstract Introduction Materials and Methods Results Discussion Disclosure of Potential... Acknowledgments References

 
The authors indicate no potential conflicts of interest.

	ACKNOWLEDGMENTS

Top Abstract Introduction Materials and Methods Results Discussion Disclosure of Potential... Acknowledgments References

 
The authors strongly acknowledge the support of Claudia Ortmeier for assistance with real-time PCR experiments and the help of Jeanine Müller-Keuker for preparation of the manuscript.

	REFERENCES

Top Abstract Introduction Materials and Methods Results Discussion Disclosure of Potential... Acknowledgments References

 

1. Pesce M, Gross MK, Schöler HR. In line with our ancestors: Oct-4 and the mammalian germ. Bioessays 1998;209:722–732.[CrossRef][Medline]

2. Pesce M, Schöler HR. Oct-4: control of totipotency and germline determination. Mol Reprod Dev 2000;554:452–457.[CrossRef][Medline]

3. Nichols J, Zevnik B, Anastassiadis K et al. Formation of pluripotent stem cells in the mammalian embryo depends on the POU transcription factor Oct4. Cell 1998;953:379–391.[CrossRef][Medline]

4. Boiani M, Kehler J, Schöler HR. Activity of the germline-specific Oct4-GFP transgene in normal and clone mouse embryos. Methods Mol Biol 2004;254:1–34.[Medline]

5. Cheng L, Sung MT, Cossu-Rocca P et al. OCT4: biological functions and clinical applications as a marker of germ cell neoplasia. J Pathol 2007;2111:1–9.[CrossRef][Medline]

6. Hochedlinger K, Yamada Y, Beard C, Jaenisch R. Ectopic expression of Oct-4 blocks progenitor-cell differentiation and causes dysplasia in epithelial tissues. Cell 2005;1213:465–477.[CrossRef][Medline]

7. Atlasi Y, Mowla SJ, Ziaee SA, Bahrami AR. OCT-4, an embryonic stem cell marker, is highly expressed in bladder cancer. Int J Cancer 2007;1207:1598–1602.[CrossRef][Medline]

8. Ezeh UI, Turek PJ, Reijo RA, Clark AT. Human embryonic stem cell genes OCT4, NANOG, STELLAR, and GDF3 are expressed in both seminoma and breast carcinoma. Cancer 2005;10410:2255–2265.[CrossRef][Medline]

9. Tai MH, Chang CC, Kiupel M, Webster JD, Olson LK, Trosko JE. Oct4 expression in adult human stem cells: evidence in support of the stem cell theory of carcinogenesis. Carcinogenesis 2005;262:495–502.[Abstract/Free Full Text]

10. Trosko JE. From adult stem cells to cancer stem cells: Oct-4 Gene, cell-cell communication, and hormones during tumor promotion. Ann N Y Acad Sci 2006;1089:36–58.[CrossRef][Medline]

11. Ponti D, Costa A, Zaffaroni N et al. Isolation and in vitro propagation of tumorigenic breast cancer cells with stem/progenitor cell properties. Cancer Res 2005;6513:5506–5511.[Abstract/Free Full Text]

12. Iki K, Pour PM. Expression of Oct4, a stem cell marker, in the hamster pancreatic cancer model. Pancreatology 2006;64:406–413.[CrossRef][Medline]

13. Gibbs CP, Kukekov VG, Reith JD et al. Stem-like cells in bone sarcomas: implications for tumorigenesis. Neoplasia 2005;711:967–976.[CrossRef][Medline]

14. Zangrossi S, Marabese M, Broggini M et al. Oct-4 expression in adult human differentiated cells challenges its role as a pure stem cell marker. Stem Cells 2007;257:1675–1680.[Abstract/Free Full Text]

15. Pan G, Qin B, Liu N, Schöler HR, Pei D. Identification of a nuclear localization signal in OCT4 and generation of a dominant negative mutant by its ablation. J Biol Chem 2004;27935:37013–37020.[Abstract/Free Full Text]

16. Sylvester I, Schoeler HR. Regulation of the Oct-4 gene by nuclear receptors. Nucleic Acids Res 1994;226:901–911.[Abstract/Free Full Text]

17. Yeom YI, Fuhrmann G, Ovitt CE et al. Germline regulatory element of Oct-4 specific for the totipotent cycle of embryonal cells. Development 1996;1223:881–894.[Abstract]

18. Brehm A, Ohbo K, Schöler H. The carboxy-terminal transactivation domain of Oct-4 acquires cell specificity through the POU domain. Mol Cell Biol 1997;171:154–162.[Abstract]

19. Botquin V, Hess H, Fuhrmann G et al. New POU dimer configuration mediates antagonistic control of an osteopontin preimplantation enhancer by Oct-4 and Sox-2. Genes Dev 1998;1213:2073–2090.[Abstract/Free Full Text]

20. Liedtke S, Enczman J, Waclawczyk S, Wernet P, Kogler G. Oct4 and its pseudogenes confuse stem cell research. Cell Stem Cell 2007;14:364–366.[CrossRef][Medline]

21. Kotoula V, Papamichos SI, Lambropoulos AF. Revisiting OCT4 expression in peripheral blood mononuclear cells. STEM CELLS 2008;26:290–291.[Abstract/Free Full Text]

22. Lengner C, Camargo F, Hochedlinger K et al. Oct4 expression is not required for mouse somatic stem cell self-renewal. Cell Stem Cell 2007;14:403–415.[CrossRef][Medline]

23. Palumbo C, van Roozendaal K, Gillis AJ et al. Expression of the PDGF alpha-receptor 1.5 kb transcript, OCT-4, and c-KIT in human normal and malignant tissues Implications for the early diagnosis of testicular germ cell tumours and for our understanding of regulatory mechanisms. J Pathol 2002;1964:467–477.[CrossRef][Medline]

24. Nordhoff V, Hubner K, Bauer A, Orlova I, Malapetsa A, Schöler HR. Comparative analysis of human, bovine, and murine Oct-4 upstream promoter sequences. Mamm Genome 2001;124:309–317.[CrossRef][Medline]

25. Do JT, Han DW, Gentile L et al. Erasure of cellular memory by fusion with pluripotent cells. STEM CELLS 2007;25:1013–1020.[Abstract/Free Full Text]

26. Suo G, Han J, Wang X et al. Oct4 pseudogenes are transcribed in cancers. Biochem Biophys Res Commun 2005;3374:1047–1051.[CrossRef][Medline]

This article has been cited by other articles:

				C. R. Jeter, M. Badeaux, G. Choy, D. Chandra, L. Patrawala, C. Liu, T. Calhoun-Davis, H. Zaehres, G. Q. Daley, and D. G. Tang Functional Evidence that the Self-Renewal Gene NANOG Regulates Human Tumor Development Stem Cells, May 1, 2009; 27(5): 993 - 1005. [Abstract] [Full Text] [PDF]

				Q. WANG, W. HE, C. LU, Z. WANG, J. WANG, K. E. GIERCKSKY, J. M. NESLAND, and Z. SUO Oct3/4 and Sox2 Are Significantly Associated with an Unfavorable Clinical Outcome in Human Esophageal Squamous Cell Carcinoma Anticancer Res, April 1, 2009; 29(4): 1233 - 1241. [Abstract] [Full Text] [PDF]

				J. E. Trosko REVIEW PAPER: Cancer Stem Cells and Cancer Nonstem Cells: From Adult Stem Cells or from Reprogramming of Differentiated Somatic Cells Vet. Pathol., March 1, 2009; 46(2): 176 - 193. [Abstract] [Full Text] [PDF]

				Y. Atlasi, S. J. Mowla, S. A.M. Ziaee, P. J. Gokhale, and P. W. Andrews OCT4 Spliced Variants Are Differentially Expressed in Human Pluripotent and Nonpluripotent Cells Stem Cells, December 1, 2008; 26(12): 3068 - 3074. [Abstract] [Full Text] [PDF]

				N. Mizuno and M. Kosaka Novel Variants of Oct-3/4 Gene Expressed in Mouse Somatic Cells J. Biol. Chem., November 7, 2008; 283(45): 30997 - 31004. [Abstract] [Full Text] [PDF]

				N. Kaltz, A. Funari, S. Hippauf, B. Delorme, D. Noel, M. Riminucci, V. R. Jacobs, T. Haupl, C. Jorgensen, P. Charbord, et al. In Vivo Osteoprogenitor Potency of Human Stromal Cells from Different Tissues Does Not Correlate with Expression of POU5F1 or Its Pseudogenes Stem Cells, September 1, 2008; 26(9): 2419 - 2424. [Abstract] [Full Text] [PDF]

				M. Monk, M. Hitchins, and S. Hawes Differential expression of the embryo/cancer gene ECSA(DPPA2), the cancer/testis gene BORIS and the pluripotency structural gene OCT4, in human preimplantation development Mol. Hum. Reprod., June 1, 2008; 14(6): 347 - 355. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Supplemental Data All Versions of this Article: 2007-0657v1 26/3/692    most recent Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints/Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Cantz, T. Articles by Schöler, H. R. Search for Related Content PubMed PubMed Citation Articles by Cantz, T. Articles by Schöler, H. R.