First published online February 14, 2008
Stem Cells
Vol. 26 No.
5
May 2008, pp.
1109
-1116
doi:10.1634/stemcells.2007-0801; www.StemCells.com
© 2008 AlphaMed Press
OPEN ACCESS ARTICLE
Alkaline Phosphatase-Positive Colony Formation Is a Sensitive, Specific, and Quantitative Indicator of Undifferentiated Human Embryonic Stem Cells
Michael D. O'Connora,
Melanie D. Kardela,
Ioulia Iosfinaa,
David Youssefa,
Min Lua,
Michael M. Lia,
Suzanne Vercauterena,
Andras Nagyb,
Connie J. Eavesa
aTerry Fox Laboratory, BC Cancer Agency, Vancouver, British Columbia, Canada;
bSamuel Lunenfeld Research Institute, Mount Sinai Hospital, Toronto, Ontario, Canada
Key Words. Human embryonic stem cell • Pluripotent • Colony-forming cell • Differentiation • SSEA3 • OCT4
Correspondence:
Correspondence: Michael O'Connor, Ph.D., Terry Fox Laboratory, 675 West 10th Avenue, Vancouver, British Columbia, Canada V5Z 1L3. Telephone: 604-675-8000; Fax: 604-877-0712; e-mail: moconnor{at}bccrc.ca
Received on September 20, 2007;
accepted for publication on February 6, 2008.
First published online in STEM CELLS EXPRESS February 14, 2008.
 |
ABSTRACT
|
|---|
Human embryonic stem cells (hESCs) can be maintained in vitro as immortal pluripotent cells but remain responsive to many differentiation-inducing signals. Investigation of the initial critical events involved in differentiation induction would be greatly facilitated if a specific, robust, and quantitative assay for pluripotent hESCs with self-renewal potential were available. Here we describe the results of a series of experiments to determine whether the formation of adherent alkaline phosphatase-positive (AP+) colonies under conditions optimized for propagating undifferentiated hESCs would meet this need. The findings can be summarized as follows. (a) Most colonies obtained under these conditions consist of
30 AP+ cells that coexpress OCT4, NANOG, SSEA3, SSEA4, TRA-1-60, and TRA-1-81. (b) Most such colonies are derived from SSEA3+ cells. (c) Primary colonies contain cells that produce secondary colonies of the same composition, including cells that initiate multilineage differentiation in embryoid bodies (EBs). (d) Colony formation is independent of plating density or the colony-forming cell (CFC) content of the test population over a wide range of cell concentrations. (e) CFC frequencies decrease when differentiation is induced by exposure either to retinoic acid or to conditions that stimulate EB formation. Interestingly, this loss of AP+ clonogenic potential also occurs more rapidly than the loss of SSEA3 or OCT4 expression. The CFC assay thus provides a simple, reliable, broadly applicable, and highly specific functional assay for quantifying undifferentiated hESCs with self-renewal potential. Its use under standardized assay conditions should enhance future elucidation of the mechanisms that regulate hESC propagation and their early differentiation.
Disclosure of potential conflicts of interest is found at the end of this article.
 |
INTRODUCTION
|
|---|
Human embryonic stem cells (hESCs) are unique in their ability to be maintained in vitro as pluripotent cells that can be induced to differentiate into cells belonging to all three germ layers by simple manipulation of the culture conditions. This feature offers unprecedented opportunities for using hESCs in a multitude of cellular replacement therapies and for creating new models of human diseases. It is also envisaged that studies of hESCs will play a key role in the future elucidation of early events in the generation of specialized cell types and in facilitating the identification of drugs that can enhance or inhibit specific elements of either normal or aberrant developmental processes.
Since the initial establishment of methods for isolating undifferentiated hESCs [1, 2], a number of studies have led to the identification of medium components and methods of cell handling that improve the propagation of undifferentiated hESCs in vitro [3–6]. Similarly, much progress has been made in optimizing methods for inducing their differentiation into particular cell types [4, 7–9] by empirical investigation of manipulations that lead to the appearance of progenitors or more mature cells of specific lineages. In contrast, the earliest events that bring about the loss of hESC pluripotency by overcoming mechanisms that maintain their undifferentiated state have remained largely obscure. This may be attributable to the fact that simple tests to discriminate the first signs of hESC differentiation have not been clearly established. In the mouse, the definitive criterion used to identify pluripotent ESCs is an ability to contribute to the germ line of chimeric mice. This property has been associated with expression of OCT4, NANOG, alkaline phosphatase (AP), and stage-specific embryonic antigen-1 (SSEA1) [10]. An analogous functional test for hESC pluripotency is obviously precluded on ethical grounds. Therefore, a greater effort has had to focus on monitoring the expression of surrogate molecular markers of the undifferentiated state of hESCs. Currently, the most widely tested and validated panel includes OCT4, NANOG, AP, SSEA3, SSEA4, TRA-1-60, and TRA-1-81 [11]. To test for the presence of pluripotent hESCs, teratoma formation has also been used. At present, however, this requires the injection of a large number of cells (>105) and a minimum of 8 weeks for the teratomas to appear. Thus, teratoma formation is a relatively insensitive and effectively nonquantitative endpoint of little utility for most analytical applications.
Previous studies have shown that cultures used to successfully propagate undifferentiated murine ESCs (mESCs) for many months contain cells that can form single cell-derived colonies of AP+ cells [12]. In addition, it was shown that loss of this ability is one of the earliest indicators of differentiation induction [10]. Cultures used to successfully propagate hESCs have also been found to contain cells that produce colonies of AP+ cells when plated under similar conditions [5]. However, the differentiation and self-renewal properties of the hESCs with this clonogenic activity have not been well defined. We now show that a 7-day readout of colonies containing a minimum of 30 AP+ cells provides a highly specific endpoint suitable for quantifying a subset of hESCs that are SSEA3+ and pluripotent and possess extensive self-renewal potential.
 |
MATERIALS AND METHODS
|
|---|
Cells
H9 and H1 cells were purchased from WiCell Research Institute (Madison, WI, http://www.wicell.org). CA1 cells were isolated by one of us using standard procedures [11]. Approval for use of these cells as described was obtained from the Canadian Stem Cell Oversight Committee. Mouse embryo fibroblasts (MEFs) were a generous gift from StemCell Technologies (Vancouver, BC, Canada, http://www.stemcell.com).
Maintenance hESC Cultures
Undifferentiated hESCs were cultured as previously described [1, 5] in maintenance medium consisting of Dulbecco's modified Eagle's medium/F-12 medium supplemented with 20% Knockout Serum Replacer (Invitrogen, Carlsbad, CA, http://www.invitrogen.com), 0.1 mM β-mercaptoethanol (Sigma-Aldrich, St. Louis, http://www.sigmaaldrich.com), 0.1 mM nonessential amino acids, 1 mM glutamine, and 4 ng/ml human fibroblast growth factor 2 (FGF2), either in contact with mitotically inactivated MEFs or in MEF-conditioned maintenance medium on dishes coated with Matrigel (Becton, Dickinson and Company, San Jose, CA, http://www.bd.com). hESC aggregates were passaged every 7 days after enzymatic detachment using 1 mg/ml collagenase (Invitrogen). Feeder-free conditions consisting of mTeSR1 and Matrigel-coated dishes were also used [6], with the cells passaged every 7 days after enzymatic detachment using 1 mg/ml dispase. Unless otherwise stated, all reagents were obtained from StemCell Technologies.
hESC Differentiation Cultures
To induce differentiation in embryoid bodies (EBs), cells were harvested from routine maintenance cultures 5–7 days after the previous passage or from 7–15-day-old colony assays using collagenase or 0.05% trypsin (Invitrogen) supplemented with 0.5 mM CaCl2 (Sigma-Aldrich). The resulting cell aggregates were then cultured for up to 30 days in nonadherent dishes (Becton Dickinson) in maintenance medium lacking FGF2. Medium changes were performed thereafter as deemed necessary, as previously described [13–15]. For inducing differentiation with retinoic acid (RA), the medium on adherent hESCs in 5–7-day-old maintenance cultures was replaced with fresh maintenance medium lacking FGF2 and supplemented with 10–5 M RA [16, 17]. The cells were then cultured for up to 5 days with daily medium changes.
Colony Assays
For primary colony-forming cell (CFC) assays, the cells to be tested were usually incubated with TrypLE reagent (Invitrogen) for 10 minutes at 37°C, although 0.05% trypsin was used in some initial experiments. For secondary CFC assays, the entire content of each dish was harvested, and the resultant single-cell suspensions were replated. In both cases, the dissociated cell suspensions were then filtered through a 40-µm cell strainer and incubated in 0.1% nigrosine (Sigma-Aldrich) to enable viable cell numbers to be determined using a hemacytometer, and the cells were finally plated either onto MEF-containing plates in maintenance medium with 4 ng/ml FGF2 or onto Matrigel-coated plates in MEF-conditioned maintenance medium with 4 ng/ml FGF2, and cultured for 7 days. As indicated, in some experiments, cells cultured in mTeSR1 were plated onto Matrigel-coated plates in 2 ml of mTeSR1 medium [6] containing 10 µM Y-27632 (Calbiochem, Gibbstown, NJ, http://www.emdbiosciences.com) [18] for the first 24 hours and then cultured for a further 6 days in mTeSR1 medium without Y-27632. The cultures were then fixed and stained using an Alkaline Phosphatase Kit (Sigma-Aldrich) as recommended by the manufacturer. To detect coexpression of TRA-1-60 or TRA-1-81 with AP in individual colonies, these were fixed and incubated with primary antibodies against TRA-1-60 or TRA-1-81 (Abcam, Cambridge, MA, http://www.abcam.com) diluted 1:40, a fluorescein isothiocyanate (FITC)-conjugated anti-mouse IgM antibody diluted 1:100, and 5 µg/ml Hoechst 33342 (Sigma-Aldrich) to stain nuclei, as described [19]. Colonies were analyzed and photographed using a fluorescent microscope and then stained for AP as described above and rephotographed.
Karyotypic Analysis
Cells were harvested from secondary CFC assays using 1 mg/ml dispase, replated as aggregates into Matrigel-coated dishes using mTeSR1 medium, and cultured for 3 days prior to harvesting for metaphase preparation and karyotype analysis on G-banded preparations [20–22].
Colony Size Determinations
Colony sizes were either determined by directly counting cells within AP-stained colonies or inferred from approximations of the area occupied by colonies. Inferred colony sizes were based on estimated average colony diameters and the assumption that undifferentiated hESCs have an observed diameter of approximately 30 µm following fixation and AP staining. Colony diameters were estimated as the average of the length of the longest colony axis and the length of the axis perpendicular to this, measured using a micrometer in an inverted microscope. Comparisons of estimated colony cell number with actual cell number counts for a number of colonies showed this to be a reasonable method for colony cell number determination.
Flow Cytometry
Antigen expression was analyzed by flow cytometry as described [19] using the following unconjugated antibodies: anti-SSEA1, -3, and -4 (all from the Developmental Studies Hybridoma Bank, Iowa City, IA, http://www.uiowa.edu/
dshbwww); TRA-1-60 and TRA-1-81; and anti-OCT3/4 (Becton Dickinson). The respective secondary antibodies used were: FITC-conjugated anti-mouse Ig (Becton Dickinson), allophycocyanin-conjugated anti-rat IgM (Jackson Immunoresearch Laboratories, West Grove, PA, http://www.jacksonimmuno.com), and FITC-conjugated anti-mouse IgG3; FITC-conjugated anti-mouse IgM; and FITC-conjugated anti-mouse IgG1 (Becton Dickinson). Cells were analyzed using a FACSCalibur (Becton Dickinson) and FlowJo software (Tree Star, Ashland, OR, http://www.treestar.com) with gates for positive cells set as those that excluded >99% of events detected when the same cells were stained only with the appropriate fluorochrome-labeled secondary antibody.
Statistical Analyses
Tests for statistical significance were performed using either the single-tailed two-sample t test or single-tailed paired two-sample t test, as appropriate. Statistical significance was assigned to p values <.05.
RNA Analysis
RNA was extracted and purified using Absolutely RNA kits (Stratagene, Cedar Creek, TX, http://www.stratagene.com). Reverse transcription using Superscript II (Invitrogen) and quantitative real-time polymerase chain reaction using SYBR Green (Applied Biosystems, Warrington, WA, http://www.appliedbiosystems.com) was performed as described [19] using the following primers: GAPDH, CCCATCACCATCTTCCAGGAG/CTTCTCCATGGTGGTGAAGACG; OCT4, GTGGAGGAAGCTGACAACAA/CTCCAGGTTGCCTCTCACTC; NANOG, AACTGGCCGAAGAATAGCAA/CATCCCTGGTGGTAGGAAGA; TDGF1, CTGCTTTCCTCAGG-CATTTC/TGCAGACGGTGGTAGTTCTG; AFP, GTAGCGCT-GCAAACAATGAA/TCTGCAATGACAGCCTCAAG; and MSI1, CTTTGATTGCCACAGCCTTC/ACTCGTGGTCCTCAGTCAGC.
 |
RESULTS
|
|---|
Characterization of the Progeny of hESCs Generated at Clonal Densities In Vitro
A first series of experiments was undertaken to characterize the colonies produced by single-cell suspensions obtained from routinely passaged cultures of undifferentiated hESCs when plated either onto MEF-containing dishes with maintenance medium and 4 ng/ml FGF2, or onto Matrigel-coated dishes with MEF-conditioned maintenance medium and 4 ng/ml FGF2 (i.e., conditions optimized for the propagation of undifferentiated hESCs in bulk cultures). Assuming equivalent support and a cell cycle time of 15–16 hours [23] with a possible postharvest delay of entry into the cell cycle of up to 24 hours, it would be predicted that a single, self-renewing, undifferentiated hESC would complete at least five divisions and thus produce more than 32 (i.e., >25) AP+ cells within 4 days. Anticipating that not all of these divisions would be symmetric self-renewal divisions, as some of the progeny would be likely to undergo spontaneous differentiation and/or death, we first analyzed the AP+ cell content of colonies present after 7 days.
For multiple hESC lines, most of the colonies present after 7 days contained at least 30 cells, and the majority of these were AP+ (Fig. 1A, 1B); colonies containing no AP+ cells were rarely observed. Costaining of individual colonies for expression of TRA antigens and AP (Fig. 2A–2C) and more extensive flow cytometric analyses of cells from resuspended 7-day colonies demonstrated that the majority of the cells present within the colonies expressed many markers of undifferentiated hESCs, including SSEA3 and OCT4 (Fig. 2D) as well as SSEA4, TRA-1-60, and TRA-1-81 (data not shown), with few cells expressing the differentiation-related antigen SSEA1 (Fig. 2D).

View larger version (39K):
[in this window]
[in a new window]
|
Figure 1. Most 7-day colonies produced from single human embryonic stem cells (hESCs) contain 30 alkaline phosphatase-positive (AP+) cells. (A): Photomicrograph of a typical AP+ colony in this case from H9 hESCs (magnification, x5). (B): Histograms showing size distribution of AP+ colonies calculated by direct cell counts and derived from assays of undifferentiated H9 (n = 3) and CA1 (n = 3) hESCs.
|
|

View larger version (34K):
[in this window]
[in a new window]
|
Figure 2. Phenotype of CFC progeny. (A–C): Representative example of a CFC-derived colony costained for alkaline phosphatase activity (A), DNA using Hoechst 33342 (B), and TRA-1-60 (C). (D, E): Fluorescence-activated cell sorting profiles of the pooled clonal progeny of cells from undifferentiated H9 cultures (D) and 10-D cultured H9 EBs (E), plated as single cells at 103–104 cells per cm2 7–10 D prior to being harvested, stained, and analyzed for the pluripotency- or differentiation-related antigens indicated (data are representative of two independent experiments). Abbreviations: CFC, colony-forming cell; D, day; FSC, forward scatter.
|
|
To further investigate the specificity of AP+ colony formation for detecting undifferentiated hESCs, we then examined the types of colonies generated under the same assay conditions using cells obtained from 10-day differentiating EBs, since EBs would be expected to contain reduced numbers of undifferentiated hESCs. Flow cytometry again showed that most of the cells within the colonies thus obtained expressed SSEA3 and OCT4 (Fig. 2E) as well as SSEA4, TRA-1-60, and TRA-1-81 (data not shown), with few cells expressing the differentiation-related antigen SSEA1 (Fig. 2E). Interestingly, colonies containing no AP+ cells were rarely observed, indicating that loss of clonogenic potential under the conditions used here may precede loss of AP expression. Taken together, these results show that the ability of hESCs to proliferate when cultured at clonal densities is a property restricted to cells that generate almost exclusively progeny with the features of undifferentiated cells.
AP+ Colonies Are Produced by Pluripotent Self-Renewing SSEA3+ hESCs
To characterize the cells that form AP+ colonies under the conditions described, we next investigated their SSEA3 status by analyzing the distribution of AP+ clonogenic cells among fluorescence-activated cell sorting-sorted SSEA3+ and SSEA3– cells isolated both from cultures of bulk undifferentiated hESCs and from 8-day differentiating EBs. Experiments with H9 hESCs showed that the majority of cells in the undifferentiated cultures were SSEA3+ (80% ± 8%), as were the majority of cells in 8-day EBs (67% ± 10%). In both cases, almost all of the cells that made AP+ colonies were contained within the SSEA3+ fraction: 96% ± 1% of the CFCs from cultures of undifferentiated hESCs and 91% ± 2% of the CFCs from the EBs. Interestingly, in these 8-day EBs, the decrease in CFC frequency (5.1-fold: from 0.17% to 0.033%; SSEA3+ and SSEA3– combined) was
4-fold greater than the decrease in frequency of SSEA3+ cells (1.2-fold: from 80% to 67%), suggesting that downregulation of SSEA3 expression, like downregulation of AP expression, may occur after loss of clonogenicity upon differentiation induction in EBs.
To determine whether the colonies obtained were derived from cells with multilineage differentiation potential, we examined the ability of their clonal progeny to generate differentiating EBs. Accordingly, unfixed colonies were harvested from 7–15-day primary CFC assay cultures, and as outlined in Figure 3A (i and ii), the cells were then used either for immediate RNA analysis or were first transferred to conditions that promote the formation of EBs, which were then subjected to RNA analysis. Figure 3B shows the results obtained for EBs derived from the progeny of CFCs present in undifferentiated hESC cultures. Figure 3C shows similar results for EBs derived from the progeny of CFCs that are still detectable in differentiating bulk EB cultures. In both cases the colony-derived EBs were characterized by a higher expression of genes that are hallmarks of various lineages (AFP, MSI1) and a decreased expression of genes associated with maintenance of the pluripotent state (OCT4, NANOG, and TDGF1) by comparison with cells within primary colonies shown to contain mostly undifferentiated hESCs. Thus, regardless of their source, hESCs with AP+ clonogenic activity are pluripotent cells able to generate EBs containing differentiating cells.

View larger version (18K):
[in this window]
[in a new window]
|
Figure 3. Clonogenic hESCs are pluripotent, self-renewing cells. (A): Experimental design used to compare the properties of CFCs obtained from undifferentiated cultures of H9 cells and 8-day EBs generated from H9 cultures. (B): Transcript levels in cells from 7–15-day-old primary colonies obtained from undifferentiated H9 cultures (black bars), and EBs derived from such colonies (gray bars). (C): Transcript levels in cells from 7–15-day-old primary colonies obtained from 8-day EBs (black bars) and EBs derived from such colonies (gray bars). Altered transcript levels in the colony-derived EBs shown in both (B) and (C) demonstrate expected evidence of multilineage differentiation. (D): Frequency of secondary CFCs in cells harvested from 7–15-day-old primary colonies originally initiated with cells from bulk cultures of undifferentiated hESCs (black bar; n = 4) or EBs (gray bar; n = 4). A 12–214-fold expansion of CFCs was seen during colony formation depending on the period of colony growth. (Values shown are the mean ± SEM.) Abbreviations: CFC, colony-forming cell; EB, embryoid body; hESC, human embryonic stem cell.
|
|
In a similar set of experiments, we asked whether the progeny of CFCs from the same two sources (i.e., bulk cultures of undifferentiated H9 hESCs and bulk H9 EB cultures) included cells with secondary AP+ colony-forming ability. As shown in Figure 3D, the primary colonies derived from either source contained large numbers of secondary AP+ CFCs. Cytogenetic analysis of 20 metaphases prepared on the pooled progeny of secondary CFCs derived from H9 hESCs demonstrated that these were all normal, indicating that this sequential cloning protocol does not select for karyotypically abnormal cells.
AP+ Colony Yield Is Linearly Related to the Number of hESCs Plated
We then asked whether the frequency of CFC detected is independent of the density of test cells plated, a condition required to enable the use of AP+ colony formation to quantify the undifferentiated hESC content of uncharacterized cell suspensions. When CFC assays were performed using MEFs, the yield of AP+ colonies varied linearly as a function of the number of cells plated per cm2 for all three hESC lines tested, and this linear relationship was evident over a wide range of input cell numbers (1–5,000 cells per cm2; Fig. 4A, 4B). CFC frequencies were similar but low (0.1%–1%) when the same test cells were assayed either using irradiated MEFs or Matrigel-coated dishes and MEF-conditioned medium (supplemental online Table 1). However, as previously reported [18], we measured 10–100-fold higher CFC frequencies (
10%) when the kinase inhibitor Y-27632 (thought to enhance the survival of dissociated hESCs) was added to the CFC assays during the first 24 hours. As a result, the linear range of the assay was reduced to 1–100 cells per cm2 (Fig. 4D, 4E) and up to 250 cells per cm2 (data not shown). Repeated application of the same assay conditions to serially propagated bulk hESC cultures showed that the frequency of CFCs remained relatively stable over consecutive passages (supplemental online Fig. 1).

View larger version (27K):
[in this window]
[in a new window]
|
Figure 4. Plating efficiency and clone size of human embryonic stem cell colony-forming cells (CFCs) is independent of input cell density over a broad range. (A, B): Data from representative experiments showing the number of alkaline phosphatase-positive (AP+) colonies obtained in assays containing mouse embryo fibroblasts (MEFs) and no Y-27632 is a linear function of input cell density for multiple cell lines (A), from 1 to 103 cells per cm2 (B) and up to 5,000 cells per cm2 (A). (C): Histogram of the distribution of MEF-cultured colony sizes (inferred from colony areas), obtained from up to 20 colonies per cell seeding density, shows that this parameter did not change as a function of input cell density over the range that gave a constant CFC detection efficiency. (D, E): Data from a representative experiment showing that the number of AP+ colonies obtained in assays using mTeSR1 medium plus Y-27632 is much higher and also a linear function of input cell number from 1 to 100 cells per cm2. Note that (D) is a higher resolution plot of the data between 1 and 100 cells per cm2 shown in (E). (F): Histogram showing the distribution of mTeSR1-cultured colony size measurements (inferred from colony areas), obtained from 20 colonies per cell seeding density, shows that this parameter did not change as a function of input cell density over the range that gave a constant CFC detection efficiency.
|
|
As a more stringent test of possible cell density or aggregation effects on CFC plating efficiency, clone size estimates were performed on colonies generated in assays initiated with different cell densities within the linear colony output range. These experiments were performed either on MEFs without Y-27632 (Fig. 4C) or in mTeSR1 with Y-27632 (Fig. 4F). The use of Y-27632 markedly enhanced the numbers of colonies generated, but neither with nor without Y-27632 was there any evidence of a cell density effect on the distribution of clone sizes obtained with different input cell densities in the range examined. Analysis of the average colony size for the data shown in both Figure 4C and 4F showed no statistically significant difference (p > .05).
Clonogenic Activity Is a Sensitive Indicator of Undifferentiated hESCs
We also compared the CFC assay with other assessments of the undifferentiated status of hESCs to evaluate early differentiation-associated changes in hESCs stimulated to differentiate using two different protocols. One of these protocols involved transferring undifferentiated hESCs to conditions that promote EB formation [13–15]. The other involved exposing undifferentiated hESCs to 10–5 M RA [16, 17]. During EB-induced differentiation, total cell numbers remained relatively constant, after an initial decrease, presumably because of the low efficiency of EB formation (Fig. 5A). In contrast, exposure to RA caused a significant increase in cell numbers by day 5 (Fig. 5C). Under both conditions, cell viability remained high (Fig. 5A, 5C), and the percentage (and total number) of cells expressing OCT4, SSEA3, or SSEA4 progressively decreased, consistent with an induction of differentiation (Fig. 5B, 5D), as found by others [16, 17]. Repeated CFC assays on the same samples showed that their frequency also decreased progressively (Fig. 5B, 5D). Importantly, for both differentiation methods, the decrease in CFCs was significantly faster and resulted in a larger overall effect than was indicated by monitoring OCT4+, SSEA3+ or SSEA4+ cells. A significant decrease in CFCs was first detected by day 10 of EB differentiation, whereas for SSEA3+ or OCT4+ cells, a significant decrease was first detected on day 15, and for SSEA4+ cells on day 30 (Fig. 5B). Similarly, a significant decrease in CFCs was first detected by day 3 of RA-induced differentiation, and this was significantly greater than the decrease detected for SSEA3+ cells at this time point (Fig. 5D). For OCT4+ or SSEA4+ cells, the first significant decrease was detected at day 4 of RA-induced differentiation. The rate of loss of CFCs was also faster than the rate of loss of TRA-1-60+ or TRA-1-81+ cells during both RA- and EB-induced differentiation (data not shown). Taken together, these results indicate that the ability to form colonies of AP+ cells (i.e., the ability of hESCs to survive, reattach, and proliferate in an undifferentiated state following generation of a single-cell suspension) provides a more rigorous and sensitive indicator of the undifferentiated status of hESCs than does expression of traditionally used indicators of pluripotency, such as OCT4, SSEA3, SSEA4, TRA-1-60, or TRA-1-81.

View larger version (23K):
[in this window]
[in a new window]
|
Figure 5. Clonogenic human embryonic stem cells are lost more rapidly upon differentiation than cells expressing standard antigenic markers. (A): High cell viability with no significant increase in cell number is associated with differentiation in EBs (H9, n = 2; CA1, n = 6). (B): CFC frequency (and total number) decreased significantly in EBs by day 10 (asterisk). (C): RA-induced differentiation (H9, n = 4; CA1, n = 2) is associated with high cell viability and a significant increase in viable cell numbers (asterisk). (D): CFC frequency (and total number) decreased significantly by day 3 after first exposure to RA (asterisk). The magnitude of the decrease for each marker at the end of the time course is shown on the right-hand side of (B) and (D) (relative to day 0). Average day 0 values ± SEM are given in supplemental online Table 2. Abbreviations: CFC, colony-forming cell; EB, embryoid body; RA, retinoic acid.
|
|
 |
DISCUSSION
|
|---|
Functional assays for detecting and quantifying stem cells within biologically heterogeneous cell populations have been powerful tools for characterizing their properties and elucidating the mechanisms of their regulation in many systems. For mESCs, such assays include the formation of chimeric mice, the formation of teratomas containing differentiated cells derived from all three germ layers, EB generation, and the formation in vitro of colonies of adherent AP+ cells. However, the definitive indicator of mESC pluripotency is the ability to contribute to the germ line of chimeric mice. Because cultures containing cells with this developmental ability in vivo are able to survive isolation as single cells and then reattach in culture, proliferate, and produce colonies of AP+ cells at high frequency [10], the in vitro assay has sometimes been used as a surrogate indicator of mESC pluripotency.
With the subsequent establishment of immortal cell lines from human blastocysts, many of the assays used to characterize mESCs have been examined for their applicability to hESCs. Chimera formation is precluded on obvious ethical grounds, but teratoma formation in immunodeficient mice has been useful to demonstrate an ability to generate the same spectrum of tissues historically obtained from mESCs [1, 2]. However, teratoma formation requires several (up to 12) weeks and large numbers (hundreds of thousands) of input cells, which are features that make it a relatively slow and insensitive method for quantifying the pluripotent cell content of a hESC culture [1, 2, 5]. The production of either EBs or AP+ colonies from single hESCs has been similarly difficult to achieve with high efficiency. As a result, the use of microscopy or flow cytometry to quantify the proportion of cells expressing OCT4 or specific cell surface antigens (i.e., SSEA3, SSEA4, SSEA1, TRA-1-60, and TRA-1-81) has gained greater appeal. However, it is not yet clear how faithful the expression of these markers is to the undifferentiated state of hESCs and hence how sensitive they are as surrogate indicators of pluripotency [24, 25].
Accordingly, a simple, sensitive, rapid, and quantitative functional assay for pluripotent hESCs would be of great interest to the field [24, 25]. The fact that hESCs were known to generate AP+ colonies made this endpoint an attractive candidate to investigate. Our first challenge was to determine a range of parameters for defining the period that should be allowed to elapse (7 days), the minimum colony size that should be adopted (30 cells;
5 divisions), and the number of AP+ stained cells present in a colony (the majority of cells). Using culture conditions that mimic those optimized for the propagation of undifferentiated hESCs, we showed that these parameters allow hESC CFCs to be detected at a relatively constant frequency between successive passages of undifferentiated hESC cultures and at levels that are similar to results reported by others [5, 26, 27]. For feeder-based conditions without Y-27632, the CFC frequency typically varied between 0.1% and 1.0%, whereas for feeder-free (mTeSR1) conditions with Y-27632, the CFC frequency was typically
10%, and the colonies produced were also larger. The robustness of the assay conditions either with or without the use of Y-27632 was demonstrated by the unchanged CFC frequencies measured and the similar colony size distribution obtained in cultures initiated with a broad range of cell concentrations, from 1,000 down to 1 cell per cm2 for feeder-based conditions without Y-27632 and from 100 down to 1 cell per cm2 for feeder-free conditions with Y-27632. Together, these findings argue that cell aggregation is not a major contributing factor affecting colony formation.
To further characterize the cells from which these colonies develop, we investigated additional phenotypic and functional properties. Most CFCs proved to be SSEA3-expressing cells, even in cultures containing readily detectable differentiating cells. Characterization of the progeny of CFCs from analyses of both pooled and individual colonies showed that these cells also displayed many phenotypic features of undifferentiated hESCs, including the expression of OCT4, NANOG, TDGF1, SSEA3, SSEA4, TRA-1-60, and TRA-1-81. Conversely, these cells did not express markers of differentiation such as SSEA1. Although these results suggest that counting unstained colonies might give the same specificity as counting AP+ colonies when using the culture conditions described in the present studies, this may not be true for all hESC maintenance or differentiation scenarios. In addition, unstained colonies are more difficult to visualize and therefore more difficult to count. Consequently, it seems more prudent and practical either to stain fixed colonies for AP activity or to stain unfixed (live) cells for antigens such as those detected by SSEA3 or TRA-1-60 antibodies in cases where retaining the cells in a viable state is desired.
Functional evidence that the CFCs represent undifferentiated hESCs was obtained by performing secondary CFC assays, which demonstrated a consistent ability of replated cells to generate secondary AP+ colonies. Analysis of the progeny of secondary CFCs indicated that they had a normal karyotype, consistent with the likelihood that the ability to survive multiple cloning events is not an exclusive property of transformed hESCs. The retained pluripotency of the harvested progeny of CFCs was also demonstrated by documenting their ability to downregulate expression of transcripts for pluripotency-related proteins (i.e., OCT4, NANOG, TDGF1) and upregulate expression of transcripts associated with differentiation (i.e., AFP, MSI1) following exposure to differentiation stimuli. Taken together, these data indicate the specificity of the AP+ colony assay for detecting a subset of undifferentiated pluripotent hESCs with extensive and likely unrestricted self-renewal potential.
Finally, we compared the sensitivity with which the CFC assay detects loss of pluripotent hESCs after initiation of their differentiation using two different protocols, namely, exposure to RA [16, 17] and exposure to conditions that induce EB formation [13–15]. These experiments confirmed that the frequency of cells expressing SSEA3, SSEA4, OCT4, TRA-1-60, and TRA-1-81 decreases under these conditions [16, 17]. They also showed that CFC frequencies decline and do so sooner and more precipitously. Thus, the ability to generate AP+ colonies may provide a more sensitive indicator of the undifferentiated stem cell state of hESCs than any of the previously documented markers. This finding recapitulates for hESCs the similar results recently reported for mESCs [10]. Use of the CFC assay may therefore be particularly valuable in combination with gene expression and/or proteomic studies to better define candidate pluripotency-related factors in hESCs or factors necessary for initiation and progression of the first differentiation programs to be activated in the human embryo.
 |
SUMMARY
|
|---|
In spite of the promise of the AP+ colony assay provided here, its low efficiency has historically detracted from its extensive use. The recent report that this efficiency can be improved markedly (10–100-fold) by initial treatment of the suspended cells with Y-27632, an inhibitor of the Rho-associated protein kinases (ROCK-I and ROCK-II) [18], was confirmed here. It is thus now possible to take advantage of the features of the CFC assay under conditions where frequencies of
10% are routinely obtained for cells harvested from routinely passaged undifferentiated hESC cultures. This is reproducibly achieved by plating 250 cells per cm2 in Matrigel-coated 35-mm tissue culture dishes containing 2 ml of mTeSR1 and 10 µM Y-27632 for the first 24 hours and then fixing and staining the colonies for AP after a total of 7 days of incubation. Using these assay conditions, AP+ colony formation should assume an increasingly important role as a simple, robust, rapid, and specific endpoint for quantifying pluripotent hESCs in many basic and applied investigations. In addition, the low number of cells required and its potential use to generate cloned and viable pluripotent cell progeny make the CFC assay an ideal complement to the use of teratoma formation for the definitive characterization of pluripotent hESCs.
 |
DISCLOSURE OF POTENTIAL CONFLICTS OF INTEREST
|
|---|
The authors indicate no potential conflicts of interest.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Dianne Reid and Glenn Edin and the Terry Fox Laboratory Flow Cytometry Core for expert technical assistance. This work was supported by a grant from the Stem Cell Network with cofunding from StemCell Technologies, Inc. M.D.O. is a recipient of a StemCell Technologies-sponsored Canadian Institutes of Health Research (CIHR) Industrial Postdoctoral Fellowship. M.D.K. holds CIHR and Michael Smith Foundation for Health Research PhD Studentships. I.I. held a British Columbia Cancer Foundation Summer Studentship. M.L. holds a StemCell Technologies-sponsored National Sciences and Engineering Research Council Industrial R&D Fellowship. M.M.L. held a University of British Columbia Faculty of Medicine Summer Studentship, and a StemCell Network Co-operative Studentship. Grant, fellowship, and scholarship funding that supported this work was provided by the following agencies: the Canadian Stem Cell Network; StemCell Technologies, Inc.; the Canadian Institutes of Health Research; the Michael Smith Foundation for Health Research; the National Sciences and Engineering Research Council of Canada; the British Columbia Cancer Foundation; and the University of British Columbia Faculty of Medicine.
 |
REFERENCES
|
|---|
- Thomson JA, Itskovitz-Eldor J, Shapiro SS et al. Embryonic stem cell lines derived from human blastocysts. Science 1998;282:1145–1147.[Abstract/Free Full Text]
- Reubinoff BE, Pera MF, Fong CY et al. Embryonic stem cell lines from human blastocysts: Somatic differentiation in vitro. Nat Biotechnol 2000;18:399–404.[CrossRef][Medline]
- Amit M, Shariki C, Margulets V et al. Feeder layer- and serum-free culture of human embryonic stem cells. Biol Reprod 2004;70:837–845.[Abstract/Free Full Text]
- Hoffman LM, Carpenter MK. Characterization and culture of human embryonic stem cells. Nat Biotechnol 2005;23:699–708.[CrossRef][Medline]
- Xu C, Inokuma MS, Denham J et al. Feeder-free growth of undifferentiated human embryonic stem cells. Nat Biotechnol 2001;19:971–974.[CrossRef][Medline]
- Ludwig TE, Levenstein ME, Jones JM et al. Derivation of human embryonic stem cells in defined conditions. Nat Biotechnol 2006;24:185–187.[CrossRef][Medline]
- Dvash T, Ben-Yosef D, Eiges R. Human embryonic stem cells as a powerful tool for studying human embryogenesis. Pediatr Res 2006;60:111–117.[CrossRef][Medline]
- Wang L. Endothelial and hematopoietic cell fate of human embryonic stem cells. Trends Cardiovasc Med 2006;16:89–94.[CrossRef][Medline]
- Trounson A. The production and directed differentiation of human embryonic stem cells. Endocr Rev 2006;27:208–219.[Abstract/Free Full Text]
- Palmqvist L, Glover CH, Hsu L et al. Correlation of murine embryonic stem cell gene expression profiles with functional measures of pluripotency. STEM CELLS 2005;23:663–680.[Abstract/Free Full Text]
- Adewumi O, Aflatoonian B et al. International Stem Cell Initiative. Characterization of human embryonic stem cell lines by the International Stem Cell Initiative. Nat Biotechnol 2007;25:803–816.[CrossRef][Medline]
- Pease S, Braghetta P, Gearing D et al. Isolation of embryonic stem (ES) cells in media supplemented with recombinant leukemia inhibitory factor (LIF). Dev Biol 1990;141:344–352.[CrossRef][Medline]
- Itskovitz-Eldor J, Schuldiner M, Karsenti D et al. Differentiation of human embryonic stem cells into embryoid bodies comprising the three embryonic germ layers. Mol Med 2000;6:88–95.[Medline]
- Dvash T, Mayshar Y, Darr H et al. Temporal gene expression during differentiation of human embryonic stem cells and embryoid bodies. Hum Reprod 2004;19:2875–2883.[Abstract/Free Full Text]
- Zeng X, Miura T, Luo Y et al. Properties of pluripotent human embryonic stem cells BG01 and BG02. STEM CELLS 2004;22:292–312.[Abstract/Free Full Text]
- Draper JS, Pigott C, Thomson JA et al. Surface antigens of human embryonic stem cells: Changes upon differentiation in culture. J Anat 2002;200:249–258.[CrossRef][Medline]
- Henderson JK, Draper JS, Baillie HS et al. Preimplantation human embryos and embryonic stem cells show comparable expression of stage-specific embryonic antigens. STEM CELLS 2002;20:329–337.[Abstract/Free Full Text]
- Watanabe K, Ueno M, Kamiya D et al. A ROCK inhibitor permits survival of dissociated human embryonic stem cells. Nat Biotechnol 2007;25:681–686.[CrossRef][Medline]
- Ungrin M, O'Connor MD, Eaves C et al. Phenotypic analysis of human embryonic stem cells. Curr Protoc Stem Cell Biol 2007;2:1B.3.1–1B.3.25.
- Fraser C, Eaves CJ, Kalousek DK. Fluorodeoxyuridine synchronization of hemopoietic colonies. Cancer Genet Cytogenet 1987;24:1–6.[CrossRef][Medline]
- Seabright M. A rapid banding technique for human chromosomes. Lancet 1971;2:971–972.[Medline]
- Yunis JJ. New chromosome techniques in the study of human neoplasia. Hum Pathol 1981;12:540–549.[Medline]
- Becker KA, Ghule PN, Therrien JA et al. Self-renewal of human embryonic stem cells is supported by a shortened G1 cell cycle phase. J Cell Physiol 2006;209:883–893.[CrossRef][Medline]
- Laslett AL, Filipczyk AA, Pera MF. Characterization and culture of human embryonic stem cells. Trends Cardiovasc Med 2003;13:295–301.[CrossRef][Medline]
- Draper JS, Moore HD, Ruban LN et al. Culture and characterization of human embryonic stem cells. Stem Cells Dev 2004;13:325–336.[CrossRef][Medline]
- Amit M, Carpenter MK, Inokuma MS et al. Clonally derived human embryonic stem cell lines maintain pluripotency and proliferative potential for prolonged periods of culture. Dev Biol 2000;227:271–278.[CrossRef][Medline]
- Stewart MH, Bosse M, Chadwick K et al. Clonal isolation of hESCs reveals heterogeneity within the pluripotent stem cell compartment. Nat Methods 2006;3:807–815.[CrossRef][Medline]