| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
TISSUE-SPECIFIC STEM CELLS |
aDepartment of Immunology, Weizmann Institute of Science, Rehovot, Israel;
bDepartment of Gastroenterology, Sourasky Medical Center, Tel-Aviv, Israel;
cDepartment of Pathology, Tel-Aviv Sourasky Medical Center, Tel-Aviv, Israel;
dDepartment of Pediatric Surgery, Schneider Children's Medical Center, Petach Tikvah, Israel
Correspondence: Correspondence: Yair Reisner, Ph.D., Weizmann Institute of Science, Department of Immunology, Rehovot, Israel. Telephone: 972-8-9344023; Fax: 972-8-9344145; e-mail: yair.reisner{at}weizmann.ac.il
Received on August 21, 2007;
accepted for publication on February 29, 2008.
First published online in STEM CELLS EXPRESS March 13, 2008.
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionConclusionDisclosure of Potential...AcknowledgmentsReferences |
|---|
Disclosure of potential conflicts of interest is found at the end of this article.
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionConclusionDisclosure of Potential...AcknowledgmentsReferences |
|---|
Clearly, the dissociation of single hepatocytes from the extracellular matrix (ECM), nonparenchymal cells, or both can lead to loss of function, as well as to loss of important survival signals. It has been shown that a particular form of apoptosis (anoikis) may be triggered in epithelial tissues by cell detachment from the ECM, and there are many indications that anoikis takes place shortly after hepatocyte isolation [11]. Furthermore, as demonstrated recently by Kumaran et al. [12], improved engraftment and survival of transplanted hepatocytes could be attained if the recipient liver was pretreated with a fibronectin-like polymer, emphasizing the role of integrin-ECM interaction in this process.
Apparently, fetal cells may be even more sensitive to disruption of intercellular interactions, since normal development and maturation of embryonic hepatic cells necessitate precise orchestration between epithelial and mesenchymal components. These processes are also essential for appropriate maturation of transplanted fetal hepatoblasts. For example, it was shown that upon intrasplenic transplantation, only those hepatoblasts that participate in lobule formation exhibit gene expression typical of a normal developmental program and achieve terminal differentiation, whereas maturation of hepatoblasts outside an appropriate structural milieu is arrested, and the cells linger in a predifferentiation state [13, 14].
In contrast to isolated embryonic or adult hepatocytes, transplantation of liver tissue fragments that comprise all types of liver cells and ECM could be advantageous. The previous attempts of adult auxiliary liver fragment transplantation [15, 16] demonstrated the feasibility of this approach; however, no sustained proliferation of transplanted tissue was achieved in the setting of quiescent host liver. Clearly, transplantation of fetal liver fragments could potentially provide both the enhanced proliferation typical of the fetal hepatoblasts and the growth and maturation stimuli that may be supplied by the ECM or by nonparenchymal cells.
Considering the ethical limitations associated with transplantation of human embryonic tissues, the use of porcine tissues offers an attractive, unlimited source of liver cells. Xenogeneic hepatocytes have been shown to be suitable for diseased liver replacement [17]. For instance, it was demonstrated in a rat model of terminal cirrhosis that porcine hepatocytes could fulfill a metabolic function similar to that exhibited by syngeneic hepatocytes, resulting in temporary improvement of liver function [18].
Recently, we evaluated in SCID mice the proliferative potential versus risk of teratoma formation of pig embryonic liver tissues harvested at different gestational time points [19]. Our results suggested that the optimal "window" for harvest of pig embryonic liver tissue is around 4 weeks of gestation (embryonic day [E] 28). In the present study, we evaluated different parameters of the growing implants, such as the relative level of parenchymal and nonparenchymal cell types, expression of functional markers, donor and host origin of endothelial cells, and proliferation status of different cell types, as well as the role of different implantation sites, including hepatic and extrahepatic sites. Furthermore, by using this mouse model we were able to compare and demonstrate the advantage of fetal liver precursor tissue over isolated hepatoblasts, harvested at the same gestational window and implanted in the context of a quiescent host liver.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionConclusionDisclosure of Potential...AcknowledgmentsReferences |
|---|
Fetal Hepatoblast Isolation
Fetal hepatoblasts were isolated according to a modification of the standard procedure [20].
Transplantation Procedure
Transplantations of the embryonic precursors were performed under general anesthesia (2.5% 2,2,2-tribromoethanol, 97% in PBS, 10 ml/kg intraperitoneally).
Implantation Under the Kidney Capsule. Host kidney was exposed through a left lateral incision. A 1.5-mm incision was made at the caudal end of the kidney capsule, and donor precursors were grafted under the kidney capsule in fragments 1–2 mm in diameter.
Intrasplenic Implantation of Liver Tissue Fragments or Isolated Hepatocytes. Liver precursor tissue was minced to 1 x 1 mm fragments in sterile PBS. Host spleen was exposed through a left lateral incision, and a suspension of liver fragments or 2 x 106 hepatoblasts was injected into the lower pole of the spleen using a 21-gauge i.v. catheter in a total volume of 0.1 ml of PBS. Hemostasis was achieved by suture-ligature proximal to the injection site.
Intraliver Implantation of Liver Tissue Fragments. The left lobe of the liver was exposed through a midabdominal incision. The liver capsule was gently removed, and hemostasis was achieved by local pressure. The tissue fragment was positioned on eroded surface and secured in place with hemostatic mesh and biological glue application.
Evaluation of Transplant Growth and Differentiation
Histology and Immunohistochemistry. The animals receiving implants were sacrificed at 6–12 weeks after transplantation. Kidneys, spleens, or liver bearing the transplanted grafts were then removed and fixed in 4% paraformaldehyde or cryopreserved.
Tissue sections were routinely stained by hematoxylin and eosin. Assessment of graft differentiation and function was performed by histochemical and immunohistochemical labeling. Histochemistry included H&E and periodic acid-Schiff. For immunohistochemical labeling, the following antibodies were used: goat anti-pig albumin (Bethyl Inc., Montgomery, TX, http://www.bethyl.com), mouse monoclonal anti-human cytokeratin 7 (clone OV-TL 12/30; Dako, Glostrup, Denmark, http://www.dako.com), polyclonal rabbit anti-cytokeratin wide-spectrum screening (Dako), mouse monoclonal anti-human cytokeratin clone MNF116 (broad-spectrum cytokeratin; Dako), mouse anti-human Ki67 (clone MIB-1; Dako), mouse anti-vimentin (clone V9; DakoCytomation, Glostrup, Denmark, http://www.dakocytomation.com), mouse anti-porcine CD31 (AbD Serotec, Raleigh, NC, http://www.ab-direct.com), rat anti-mouse CD31 (clone CBL 1337; Cymbus Biotechnology, Southampton, U.K.), rat anti-porcine CD144 (VE-cadherin) (clone MCA1748; AbD Serotec), mouse anti-glial fibrillary acidic protein (clone ASTR06; NeoMarkers, Fremont, CA), mouse anti-CD163 (clone MCA2311; AbD Serotec), and cleaved caspase-3 (Asp 175) (Cell Signaling Technology, Beverly, MA, http://www.cellsignal.com). The Dako peroxidase Envision System for detection of mouse primary antibody was applied. In the case of goat primary antibody, we used secondary biotinylated antibody (Jackson Immunoresearch Laboratories, West Grove, PA, http://www.jacksonimmuno.com) following streptavidin peroxidase (Dako). For all peroxidase labeled sections, diaminobenzidine was used as a chromagen. Diaminobenzidine was used as a chromagen. Tissue sections were counterstained with hematoxylin. For immunofluorescence secondary antibodies, donkey anti-mouse Texas Red (Jackson Immunoresearch Laboratories), donkey anti-rat conjugated CY2 (Jackson Immunoresearch Laboratories), and donkey anti-rabbit conjugated CY2 (Jackson Immunoresearch Laboratories) were applied. For all immunohistochemical stainings, a negative control was run using the same technique but omitting the primary antibody while adding the labeled secondary antibody.
Morphometric Analysis. E28 liver implants were formalin-fixed and embedded in paraffin 2 days and 2 weeks after transplantation (three animals at each time point). Twenty consecutive 80-µm sections were cut from each implant and stained. The areas of interest were quantified using the Image Pro program (Media Cybernetics, Crofton, MD, http://www.mediacy.com).
Enzyme-Linked Immunosorbent Assay Measurements for Pig Albumin. Pig albumin in mouse serum was measured by a standard enzyme-linked immunosorbent assay (ELISA) using goat anti-pig albumin antibodies (human, mouse, and bovine adsorbed), affinity-purified and horseradish peroxidase-conjugated (catalog nos. A100–210A and A100–210P; Bethyl).
Reverse Transcriptase-Polymerase Chain Reaction. Grafts were dissected from the subcapsular site and frozen in liquid nitrogen. Total RNA was isolated using the Gentra Total RNA Purification Kit (Gentra Systems, Minneapolis, www.gentra.com). Purified RNA was then transcribed into cDNA and amplified using pig-specific primers for medium-chain acyl-CoA dehydrogenase deficiency (MCAD) (5'-GAATGACTGAGGAGCCAT; 3'-GTATCTGAACATCGTTGGC), Gaucher (5'-ACACACCGCAATGTCCTGC; 3'-CACCGTGTCCAAGTTGTTCT), ornithine transcarbamylase (OTC) (5'-AGGCGAGTAATCTGTCAGCA; 3'-AAGAAGCATCCATCCCAATC), and albumin (5'-CGTCGAGATACATACAAGA; 3'-TAATGGCATAATAAAGGAGT). Pig β actin (5'-AGGTCATCACCATCGG; 3'-CCGATCCACACGGAGTA) and mouse β actin (5' TGGAATCCTGTGGCATCCATGAAAC; 3'TAAAACGCAGCTCAGTAACAGT-CCG) were used as housekeeping genes.
Statistical Analysis. Comparisons between groups were evaluated by Student's t test. Data were expressed as mean ± SD and were considered statistically significant if p values were .05 or less.
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionConclusionDisclosure of Potential...AcknowledgmentsReferences |
|---|
|
One of the challenges for embryonic tissue transplantation is the avascular nature of the grafts, which necessitates prompt neovascularization to ensure implant survival. As E28 pig fetal liver abounds with endothelial precursors (Fig. 1G), rapid angiogenesis and revascularization are already evident at the first days after implantation (data not shown). Six weeks after transplantation, immunofluorescent double staining (Fig. 3A) with pig- and mouse-specific anti-CD31 revealed tight interaction of blood vessels of host and donor origin in the implant. Thus, the blood supply of the implant is provided mostly by donor-derived blood vessels (red) that form a network with host blood vessels penetrating the graft (green). Long-term follow-up revealed penetration of donor blood vessels into the implant-bearing organ and formation of chimeric blood vessels with endothelial cells of host and donor origin lining the same vessel wall (Fig. 3B).
|
|
The proliferative potential of the embryonic liver tissue, compared with that of the adult liver, might represent a major advantage of the former source. As can be seen in Figure 4, E28 liver implants retain high proliferative capacity for prolonged time periods after transplantation, despite the absence of partial hepatectomy or any other exogenous proliferative stimulus. Thus, proliferation of hepatocytes and nonparenchymal hepatic cells was noted 5 days (Fig. 4A) and 6 weeks (Fig. 4A) after transplantation. To further establish, quantitatively, this important aspect, a morphometric analysis of the E28 pig liver tissue before and after transplantation was applied. This analysis revealed that although in adult pig liver Ki67 staining is expressed in only 0.9% ± 0.1% of hepatocytes, this proliferation marker is expressed in 26.3% ± 2.7% of the hepatoblasts in the E28 pig fetal liver prior to transplantation. Most importantly, 6 weeks after transplantation, 13.9% ± 1.5% of hepatocytes remained positive in implants of E28 pig liver fragments under the kidney capsule.
|
To address the question of whether the growing liver tissue could afford a new potential source for the correction of monogenic diseases, we initially tested, at the mRNA level, the expression of several enzymes involved in such diseases, including MCAD, Gaucher (glucocerebrosidase), and OTC. As can be seen in Figure 5, prior to transplantation, intact porcine E28 liver tissue exhibited marked expression of tested mRNA levels, and this expression persisted in implants after transplantation of E28 liver tissue into SCID mice 8 weeks after transplantation.
|
Systematic evaluation of the implant growth and development in the three different sites involved the maximal mass of tissue that can be administered at each specific location. Thus, approximately one-quarter of the E28 liver was transplanted into the spleen, whereas approximately one-eighth could be transplanted into the liver or under the kidney capsule of each recipient SCID mouse. As can be seen in Figure 6, typical lobular arrangement of hepatocytes was noted in all implantation sites when examined 6 weeks after transplantation of E28 pig liver fragments. Although grafts transplanted into the liver (Fig. 6A–6D) and spleen (Fig. 6I–6L) appeared larger than the renal subcapsular ones (Fig. 6E–6H), all implants contained fully functional hepatocytes, exhibiting albumin production (Fig. 6B, 6F, 6J) and glycogen storage (Fig. 6C, 6G, 6K), as well as mature bile ducts (Fig. 6D, 6H, 6L).
|
Engraftment and Functionality of Pig Fetal Liver Tissue Fragments Versus Isolated Hepatocytes
To evaluate the growth potential of E28 embryonic pig liver tissue fragments, in comparison with E28 fetal hepatocytes, the tested tissue or cells were implanted into the spleen of SCID mice, the route generally used in transplantation of isolated hepatocytes. Fetal hepatoblasts were isolated from E28 pig fetal liver by a standard procedure [20], with viability of more than 90%, as defined by trypan blue staining. The maximal possible number of isolated hepatocytes (2 x 106) that are free of life-threatening complications, such as portal vein thrombosis, was injected. Approximately twice as many cells can be transplanted when using fetal liver fragments, as the relatively large size of the tissue fragments prevents their passage into the portal circulation.
To assess growth and function after transplantation, secretion of pig albumin into the circulation of the recipient mice was monitored by an ELISA specific for pig albumin. As shown in Figure 7E, negligible albumin secretion was noted after transplantation of isolated fetal hepatocytes. In contrast, albumin secretion was detected as early as 2 days after transplantation of embryonic liver fragments, followed by substantial and stable increase in the levels of serum albumin during a 2-week follow-up period. This remarkable difference in the capacity for albumin secretion was concordant with histological findings. As can be seen in Figure 7, 3 months after intraspleen transplantation, implants developed from E28 liver tissue fragments occupied a substantial part of the host spleen, exhibiting characteristics of mature liver, including albumin production (Fig. 7C) and glycogen production and storage (Fig. 7D). In contrast, isolated E28 hepatocytes gave rise to only a few clusters of cells exhibiting albumin production (Fig. 7A), with minor glycogen stores (Fig. 7B). No transplanted hepatocytes could be detected in the host liver by pig-specific albumin and cytokeratin staining (data not shown).
|
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionConclusionDisclosure of Potential...AcknowledgmentsReferences |
|---|
In the present study, we show extensive proliferation of hepatic cells after porcine fetal liver fragment transplantation into SCID mice, without any preparative manipulations of the host. In contrast to transplantation of isolated pig fetal hepatocytes, transplantation of fetal liver fragments led to rapid onset of mature liver function (albumin production) and formation of organized liver tissue, which, in addition to hepatocytes and cholangiocytes, is composed of all types of nonparenchymal cells, as well as other supporting stromal elements. Remarkably, a high proliferation rate, documented by staining for Ki67, in the E28 pig embryonic implants was sustained for at least 6 weeks after transplantation. Importantly, this high rate of proliferation is not offset by a parallel level of apoptosis, as documented by staining for cleaved caspase-3. Accordingly, morphometric analysis of implant size during the initial 2 weeks post-transplant revealed an increase of approximately fourfold in the implant volume.
This striking difference in proliferative capacity between isolated fetal hepatoblasts and fetal liver fragments could be explained in part by communication between hepatoblasts and nonparenchymal cells of the implanted fragments and by the influence of the extracellular component, which is preserved in implanted fragments and is essential for normal liver proliferation, maturation, and function. Previous studies demonstrated that the differentiation and growth of the developing liver is controlled by cross-talk between mesenchymal cells and epithelial cells (reviewed in [23]). Thus, proliferation of the liver cells was shown to require communication between hepatic growth factor (HGF) (expressed in mesenchymal cells) and cMet (the receptor to HGF, expressed on epithelial cells), as mouse embryos lacking either HGF or cMet exhibit severely hypoplastic livers [24, 25]. In addition, the role of transforming growth factor β (TGF-β) in hepatic cell proliferation was demonstrated in embryos lacking one of the Smad proteins, which are transcription factors regulating expression of TGF-β target genes. Livers of Smad2+/– or Smad3+/– mice exhibit severe reduction in liver cell proliferation and increased apoptotic cell death, although expression of hepatic lineage marker genes is unaffected [26]. In addition to mesenchymal cells arising from septum transversum, early endothelial cells were shown to provide signals to hepatic cells that are necessary for the support of hepatic morphogenesis prior to development of vascular function [27]. Finally, the paracrine action of oncostatin M, an interleukin-6 family cytokine derived by hematopoietic cells in the developing liver, was shown to be required for liver development from the mid-fetal to neonatal stages [28]. Taken together, these studies reveal the complex network of signals among epithelial, mesenchymal, endothelial, and hematopoietic cells; these signals control normal liver proliferation and development and are obviously disrupted during the process of hepatocyte isolation. Using immunohistochemistry, we clearly demonstrated (Fig. 3) that E28 liver fragments before transplantation comprise all the aforementioned types of cells. Thus, such embryonic liver fragments might be less affected and more capable of supporting growth and differentiation following implantation.
Previous studies investigating transplantation of syngeneic rat adult liver fragments demonstrated engraftment and neovascularization of the implants, but no proliferation of implanted tissue was noted [15]. In our study, we clearly demonstrated that embryonic liver fragments that are abundant in stem cells located in the natural stem cell niche microenvironment extensively proliferate without any exogenous stimulus.
The relative autonomous developmental program exhibited by the E28 liver fragments enables the use of different implantation sites, including extraliver implantation, under the kidney capsule or into the spleen. This could be of particular relevance in pathological situations caused by disruption of host liver architecture (cirrhosis). Isolated hepatocytes, in contrast to tissue fragments, cannot establish normal liver structure and function after transplantation, unless incorporated into the host liver. Clearly, in a fibrotic and cirrhotic liver, this site is unacceptable, exposing the transplanted hepatocytes to the same detrimental milieu experienced by the host hepatocytes. Thus, in such a clinical setting, the use of extraliver transplantation sites for implantation of embryonic liver fragments affords a potential advantage. On the other hand, in monogenic metabolic diseases in which the liver is not damaged, transplantation of the E28 pig liver fragments into the liver could constitute a preferred site for implantation.
Despite the high rate of proliferation and growth exhibited by the implants, the serum levels of pig albumin remain relatively low. A similar finding was also observed in a humanized-SCID mouse model recently described by Meuleman et al. [29]. This model is based on transgenic SCID mice that express the hepatotoxic protein urokinase plasminogen activator. The toxicity of liver in this mouse can be "rescued" by engrafting xenogeneic (human) hepatocytes. Thus, although infusion of human hepatocytes leads to repopulation of up to 87% of mouse liver by the latter cells, the human albumin blood level is less than one-fifth of the total level. The relatively low human albumin level is attributed to a less-than-optimal "cross-talk" between human cells and the mouse environment. However, the low levels of pig serum albumin in the present implantation system (in the context of a quiescent and not an injured liver) might be explained in part by negative homeostatic control exerted by the healthy host liver. It remains to be determined whether in larger animals (which might exhibit a different pattern of organ size control) or in the setting of liver disease, the growing liver tissue will be associated with enhanced metabolic function.
Regardless of the site of implantation, it should be noted that newly formed pig tissues or organs growing and developing in the recipient after transplantation might be capable of using the recipient's vasculature. These types of newly formed tissues, if grown in primates in the presence of pre-existing anti-pig antibodies directed predominantly against pig vasculature, are likely to selectively use host type vasculature, which can evade these antibodies. Thus, considering that donor endothelial cells serve as major targets of immune cellular responses, the potential vascularization of the growing tissue by host type endothelial cells could likely afford an overall reduced immunogenicity. Our ongoing experiments in the nonhuman primate (NHP) model with embryonic pig pancreatic tissue indeed demonstrate this advantage (unpublished results), but further experimentation in NHP with pig liver precursor tissues is warranted.
|
CONCLUSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionConclusionDisclosure of Potential...AcknowledgmentsReferences |
|---|
|
DISCLOSURE OF POTENTIAL CONFLICTS OF INTEREST |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionConclusionDisclosure of Potential...AcknowledgmentsReferences |
|---|
|
ACKNOWLEDGMENTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionConclusionDisclosure of Potential...AcknowledgmentsReferences |
|---|
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionConclusionDisclosure of Potential...AcknowledgmentsReferences |
|---|
This article has been cited by other articles:
|
|
 |
|
  D. Tchorsh-Yutsis, G. Hecht, A. Aronovich, E. Shezen, Y. Klionsky, C. Rosen, R. Bitcover, S. Eventov-Friedman, H. Katchman, S. Cohen, et al. Pig Embryonic Pancreatic Tissue as a Source for Transplantation in Diabetes: Transient Treatment With Anti-LFA1, Anti-CD48, and FTY720 Enables Long-Term Graft Maintenance in Mice With Only Mild Ongoing Immunosuppression Diabetes, July 1, 2009; 58(7): 1585 - 1594. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| STEM CELLS | THE ONCOLOGIST | CME | ALPHAMED PRESS JOURNALS |
