First published online May 8, 2008
Stem Cells
Vol. 26 No.
7
July 2008, pp.
1749
-1757
doi:10.1634/stemcells.2007-1000; www.StemCells.com
© 2008 AlphaMed Press
TISSUE-SPECIFIC STEM CELLS |
Ex Vivo Pretreatment with Melatonin Improves Survival, Proangiogenic/Mitogenic Activity, and Efficiency of Mesenchymal Stem Cells Injected into Ischemic Kidney
Céline Miasa,
Elodie Trouchea,
Marie-Hélène Seguelasa,
Fabien Calcagnoc,
Françoise Dignat-Georgec,
Florence Sabatierc,
Marie-Dominique Piercecchi-Martic,
Laurent Danield,
Pascale Bianchia,
Denis Calisea,
Philippe Bourine,
Angelo Parinia,b,
Daniel Cussaca,b
aInstitut National de la Santé et de la Recherche Médicale, U858, Institut de Médecine Moléculaire de Rangueil, Toulouse, France;
bFaculté des Sciences Pharmaceutiques, Université Toulouse III Paul Sabatier, Toulouse, France;
cUnite Mixte de Recherche-S 608, Institut National de la Santé et de la Recherche Médicale, Université de la Méditerranée, Marseille, France;
dUniversité de la Méditerranée, Marseille, France;
eEtablissement Français du Sang, Laboratoire de Thérapie Cellulaire, Toulouse, France
Key Words. Mesenchymal stem cell • Melatonin • Survival • Angiogenesis • Therapeutic efficacy
Correspondence:
Correspondence: Angelo Parini, M.D., Ph.D., I2MR, INSERM U858, CHU Rangueil, BP 84225, 31432 Toulouse Cedex 4, France. Telephone: 33-5-61-32-36-01; Fax: 33-5-62-17-25-54; e-mail: angelo.parini{at}toulouse.inserm.fr
Received on November 27, 2007;
accepted for publication on April 28, 2008.
First published online in STEM CELLS EXPRESS May 8, 2008.
 |
ABSTRACT
|
|---|
Bone marrow mesenchymal stem cells (MSCs) have shown great potential in cell therapy of solid organs. Approaches to improving the ability of grafted MSCs to survive and secrete paracrine factors represent one of the challenges for the further development of this novel therapy. In the present study, we designed a strategy of ex vivo pretreatment with the pineal hormone melatonin to improve survival, paracrine activity, and efficiency of MSCs. Using a rat model of acute renal failure, we showed that melatonin pretreatment strongly increased survival of MSCs after intraparenchymal injection. This effect was concomitant with overstimulation of angiogenesis, proliferation of renal cells, and accelerated recovery of renal function. To gain insight into the mechanisms involved in the effects observed in vivo, melatonin was tested in vitro on cultured MSCs. Our results show that through stimulation of specific melatonin receptors, melatonin induced an overexpression of the antioxidant enzyme catalase and superoxide dismutase-1 and increased the resistance of MSCs to hydrogen peroxide-dependent apoptosis. Compared with untreated cells, MSCs incubated with melatonin displayed a higher expression of basic fibroblast growth factor and hepatocyte growth factor. In addition, conditioned culture media from melatonin-treated MSCs stimulated tube formation by endothelial progenitor cells and proliferation of proximal tubule cells in culture. In conclusion, our results show that melatonin behaves as a preconditioning agent increasing survival, paracrine activity, and efficiency of MSCs. The use of this molecule for pretreatment of stem cells may represent a novel and safe approach to improving the beneficial effects of cell therapy of solid organs.
Disclosure of potential conflicts of interest is found at the end of this article.
 |
INTRODUCTION
|
|---|
Mesenchymal stem cells are pluripotent progenitor cells that can be isolated from several tissues, in particular from bone marrow and adipose tissue [1–4]. The multilineage potential, the ability to elude detection by the host immune system, the immunomodulatory properties, and the ease of expansion in culture make mesenchymal stem cells (MSCs) particularly promising in view of cell therapy. In the last few years, several studies have shown that MSCs administration enhances structural and functional recovery of injured organs. The beneficial effects of injected MSCs have been related, in part, to their transdifferentiation in the cell phenotype of host organs [5]. More recently, it has been suggested that MSCs improve tissue regeneration through secretion of mitogenic and vasculotropic factors [6–9]. On the basis of these results, it becomes evident that strategies to increase the number of MSCs and the concentration of secreted cytokines within the injured area would significantly improve the beneficial effects of cell therapy. This goal may be achieved by direct injection of MSCs into the injured organ. However, one of the major limits of the intraparenchymal route of administration is the extensive early death of grafted cells. Indeed, different studies performed in solid organs showed that more than 80%–90% of grafted cells die within 72 hours after injection [10–14]. Different mechanisms have been involved in the early death of grafted cells, including oxidative stress, hypoxia, and inflammation [15–19]. Thus, we decided to design a strategy of ex vivo handling of MSCs to improve, at the same time, their survival and their ability to secrete beneficial cytokines after grafting. In view of a potential transfer of pretreatment protocols to the clinic, we searched for compounds possessing protective properties and potentially devoid of side effects. On the basis of these criteria, we selected the pineal hormone melatonin. This hormone regulates different physiological functions, including circadian rhythms and sleep [20]. Besides its physiological activities [21–23], melatonin is also able to reduce tissue injury by decreasing oxidative damage and stimulates cytokine secretion in immune and bone marrow cells [24–27]. In addition, melatonin is currently used as a dietary complement in human without major side effects [28, 29]. To evaluate the potential role of melatonin in protecting grafted MSCs and promoting secretion of proangiogenic/mitogenic factors, we set up an approach consisting of ex vivo melatonin-based MSC pretreatment prior to direct intraparenchymal injection in a rat model of renal ischemia-reperfusion.
 |
MATERIALS AND METHODS
|
|---|
Isolation and Culture of MSCs
Bone marrow (BM) was obtained from Lewis rats (Harlan, Gannat, France, http://www.harlan.com) weighing 180–200 g. BM from femur cavities was flushed with minimal essential medium (MEM) (ABCYs, Paris, http://www.abcysonline.com) containing 10% fetal calf serum (FCS) and 1% penicillin/streptomycin (Invitrogen, Carlsbad, CA, http://www.invitrogen.com), and the cell suspension was centrifuged (400g, 5 minutes). Then, cells were plated in culture flasks (200,000 cells per cm2). Nonadherent cells were removed after 72 hours, and MSCs were recovered by their capacity to adhere highly to plastic culture dishes. MSCs were then routinely cultured and were used at passage 3 for the experiments.
Flow Cytometry
To quantify DNA content, MSCs were permeabilized with 70 degrees ethanol (10 minutes, 4°C) and were incubated (30 minutes, 37°C) in a solution containing 500 µl of phosphate-buffered saline (PBS), 50 µl of RNase A (10 mg/ml), and 5 µl of propidium iodine (10 mg/ml; Interchim, Montiuçon, France, http://www.interchim.com). To evaluate MSC surface antigens, MSCs were incubated with anti-rat CD90/fluorescein isothiocyanate (FITC), CD106/PE, CD29/FITC, CD34/Alexa 568, CD31/PE, or CD45/PE antibody (1 hour, room temperature [RT]). Fluorescence was analyzed by flow cytometry (FACSCalibur; Becton, Dickinson and Company, Franklin Lakes, NJ, http://www.bd.com).
Ex Vivo Treatment of MSCs with Melatonin and Labeling with Quantum Dots
MSCs were treated with melatonin (5 µM) for 24 hours and extensively washed with 1x PBS. An incubation time of 24 hours was selected on the basis of preliminary experiments showing that expression of the antioxidant enzyme catalase and the cytokine basic fibroblast growth factor (b-FGF) increased in a time-dependent manner after treatment with melatonin, reaching a maximum between 16 and 24 hours (supplemental online Fig. 4). Then, MSCs were trypsinized and resuspended in MEM containing fluorescent quantum dots nanocrystals (10 nM/1 x 106 cells per 200 µl, Qtracker 655 cell labeling kit; Invitrogen). After incubation for 60 minutes at 37°C, MSCs were centrifuged (400g, 10 minutes) and resuspended in MEM prior to injection.
Renal Ischemia-Reperfusion
To prevent immunorejection of MSCs, experiments were performed in Lewis congenic rats (180–200 g, n = 60). Anesthesia was obtained by isoflurane/oxygen inhalation (3%/97%). Rats were subjected to bilateral ischemia (30 minutes) by clamping renal vessels using atraumatic vascular microclamps (Arex, Palaiseau, France, http://www.arex.fr). After 30 minutes of reperfusion, intraparenchymal injection of vehicle or MSCs (three injections of 1 x 106 cells into 30 µl of MEM) was performed in one of the two kidneys. Sham-operated animals were subjected to the same surgical procedure without clamping the renal vessels or MSC transplantation.
Histology and Immunohistochemistry
Kidney sections were collected 48 hours or 2 months after MSC injection. Paraffin sections (6 µm) of kidneys were stained with hematoxylin/eosin, Sirius red, alizarin red S, or Alcian Blue coloration using standard methods. For MSC detection, sections were incubated (90 minutes, RT) with anti-rat CD90/FITC antibody diluted 1:100 (Immunotech, Marseille, France, http://www.immunotech.fr). Fields corresponding to the injection points of MSCs were randomly selected, and quantum dots (QD) fluorescence was quantified by computerized image analysis carried out on 12 microscopic fields of three different histological preparations obtained from each animal (n
4 animals per group). Proliferating cell nuclear antigen (PCNA) expression was used as a marker for cell proliferation. Immunostaining was performed with streptavidin/biotin immunoperoxidase method (Zymed Laboratories Inc, San Francisco, http://www.zymed.com). The deparaffinized sections were immersed in 3% H2O2 in methanol for 10 minutes to quench the endogenous peroxidase activity and were incubated with biotinylated rat PCNA (1 hour, RT). After being washed with 1x PBS, the sections were incubated with peroxidase-labeled streptavidin for 10 minutes. Peroxidase staining was carried out using 3,3'-diaminobenzidine as the chromagen. Sections were counterstained using hematoxylin. The number of labeled nuclei per section was counted (magnification, x400), and the labeling index [labeled nuclei/total nuclei x 100 (%)] was calculated on 12 microscopic fields in three levels cuts from each animal (n
4 animals per group). Apoptosis was evaluated with the DeadEnd Fluorometric terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL) system according to the manufacturer's instructions (Promega, Madison, WI, http://www.promega.com). Briefly, the deparaffinized kidney sections were incubated in a 20 µg/ml proteinase K solution to permeabilize the tissues, rinsed, and fixed in 4% paraformaldehyde. The sections were then incubated with terminal deoxynucleotidyl transferase (25 U/µl) and fluorescein-12-dUTP (1 hour, 37°C). After rinsing in 1x PBS, the slides were immersed in propidium iodide solution (1 µg/µl, 15 minutes).
For angiogenesis analysis, an automatized immunohistochemistry method using the avidin-biotin-peroxidase complex was performed on a Ventana Benchmark XT instrument (Ventana Medical Systems, Inc., Illkrich, France, http://www.ventanamed.com). Tissue sections were stained using the following antibodies: polyclonal rabbit anti-human von Willebrand, diluted 1:30 (Dako, Trappes, France, http://www.dako.com); monoclonal mouse anti-human clone JC/70A, diluted 1:30 (Dako); monoclonal mouse anti-rat CD31, diluted 1:10 (Beckman Coulter, Roissy CDG, France, http://www.beckmancoulter.com); and monoclonal mouse anti-human actin smooth muscle clone 1A4, prediluted (Dako). Antigen retrieval (EDTA) was used for anti-von Willebrand and anti-CD31 immunolabeling. For angiogenesis quantification, 14 microscopic fields (magnification, x400) of three different histological preparations obtained from each animal (n
4 animals per group) were analyzed. Capillaries or isolated labeled cells were counted from cortical zone.
Reverse Transcription-Polymerase Chain Reaction and Western Blot
Total RNA was isolated from MSCs, brain, or intestine using a NucleoSpin kit (Macherey Nagel, Hoerd, Germany, http://www.macherey-nagel.com), and cDNA was synthesized from 1 µg of total RNA using SuperScript II reverse transcriptase (Invitrogen). Real-time polymerase chain reaction analysis was performed in 96-well plates using SYBR Green PCR Master Mix (ABI Prism 7000 HT Sequence Detection System; Applied Biosystems, Foster City, CA, http://www.appliedbiosystems.com). Amplification reactions (25 µl) were carried out in triplicate with 5 µl of 1:5 diluted template cDNA according to the manufacturer's protocol. Each assay was normalized by amplifying the housekeeping cDNA 18S from the same cDNA sample. Polymerase chain reaction (PCR) (MT1 and MT2) and real-time PCR (vascular endothelial growth factor
[VEGF
], insulin-like growth factor 1 [IGF1], basic fibroblast growth factor (b-FGF), hepatocyte growth factor [HGF], epithelial growth factor (EGF), granulocyte-colony stimulating factor (G-CSF), and 18S) was carried out using the following primers (Eurogentec, Seraing, Belgium, http://www.eurogentec.be) (sense/antisense): MT1, 5'GCTGGTCATCCTGTCTGTGT3'/5'GGGACTACGAAATGGAAAAC3'; MT2, 5'CCAACTGCCGCCTCCATTCG3'/5'GAAAAAAGTGTGGAGACCCG3'; VEGF
, 5'CAAAAACGAAAGCGCAAGAAA3'/5'GTCTGCGGATCTTGGACAAAC3'; IGF1, 5'GACGGGCATTGTGGATGAGT3'/5'GGATGGAACGAGCTGACTTTG3'; b-FGF, 5'GTGTGTGCGAACCGGTACCT3'/5'TATTGGACTCCAGGCGTTCAA3'; HGF, 5'CAAAACAAGGTCTGGACTCACATG3'/5'CGTCTGGCTCCCAGAAGATATG3'; EGF, 5'CTCACCCTCTCTCCTTGGAAAA3'/5'GGCGGGCATCCTGTGTG3'; G-CSF, 5'TGTGGTGGTACCCAAGAAATCAC3'/5'CCTGGGCCCCTGAGACA3'; and 18S, 5'AGCCTGCGGCTTAATTTGAC3'/5'CAACTAAGAACGGCCATGCA3'.
For Western blot, proteins were extracted from MSCs. Analyses were performed with samples normalized for protein concentration. Membranes were probed with anti-catalase (1:2,000; Sigma-Aldrich, St. Louis, http://www.sigmaaldrich.com), anti-superoxide dismutase 1 (1:200; Chemicon, Temecula, CA, http://www.chemicon.com), and anti-b-FGF (1:500; Santa Cruz Biotechnology Inc., Santa Cruz, CA, http://www.scbt.com) antibodies. Following several washes in Tris-buffered saline-Tween (0.2%), membranes were incubated to either horseradish peroxidase-conjugated anti-mouse (catalase) or anti-rabbit (superoxide dismutase 1 and b-FGF) secondary antibodies (1:10,000; Santa Cruz Biotechnology).
Conditioned Media from MSCs
MSCs in culture were incubated in the presence or absence of melatonin (5 µM) for 24 hours, and then cells were washed and maintained for 24 hours in standard medium. Conditioned media from treated or untreated MSCs were then collected and tested on endothelial progenitor or proximal tubule cells in culture.
In Vitro Detection of Cell Death and Proliferation
Necrosis and apoptosis were evaluated concomitantly on cultured cells after fluorescent staining using vital fluorescent dyes SYTO-13 (0.6 µmol/l), a permeant DNA intercalating green probe, and propidium iodide (15 µmol/l), a nonpermeant intercalating orange probe (Invitrogen), and counted with an inverted fluorescence microscope. Normal nuclei exhibited loose chromatin colored green by SYTO-13, apoptotic nuclei exhibited condensed green chromatin, and necrotic cells exhibited orange nuclei with loose chromatin. Proliferation was estimated by the quantification of the number of proximal tubule cells. Briefly, cells were washed with 1x PBS and trypsinized before being counted. All experiments were performed in triplicate.
Isolation and Culture of Human Endothelial Progenitor Cells and Rat Renal Proximal Tubule Cells
Human umbilical cord blood samples (30–50 ml) were collected from donors, in compliance with French legislation, in a sterile tube containing heparin, and endothelial progenitor cells (EPC) were isolated and cultured as previously described [31]. Briefly, mononuclear cells were isolated by density gradient centrifugation (lymphocyte separation medium; Eurobio, Les Ulis, France, http://www.eurobio.fr) and preplated in RPMI/10% FCS for 24 hours in plastic flasks. Nonadherent cells were plated onto 0.2% gelatin-coated 24-well plates (5 x 106 cells per well) and maintained in endothelial basal medium-2 (EBM-2) supplemented with EGM-2 SingleQuots (EGM-2 medium; Clonetics, Walkersville, MD, http://www.clonetics.com). The medium was changed every 4 days. The appearance of well-circumscribed colonies with cobblestone morphology was monitored daily. For expansion of EPC derived cells, colonies were trypsinized, and cells were replated on a six-well plate (passage 1). Subsequently, confluent cells were trypsinized and replated in T75 flasks for additional passages. EPC were used at passage 3. Renal proximal tubule cells were isolated from Sprague-Dawley rats (40 g), as described previously [30]. Briefly, the kidneys were removed aseptically, decapsulated, and minced coarsely in Hanks' balanced saline solution (HBSS) supplemented with 10 mM Hepes and 5 mM D-glucose, pH 7.4. The cortex was separated from the medulla and incubated in HBSS supplemented with 0.48 U/ml collagenase and 0.1% bovine serum albumin in a flask under gentle stirring (40 minutes, 37°C). To separate homogeneous populations of nephron segments, the mixture of tubules was suspended in 42% Percoll made isotonic with 10x concentrated Krebs Henseleit buffer (1.18 M NaCl, 47 mM KCl, 100 mM Hepes, 200 mM cyclamic acid, 1.26 mM MgSO4, 11.4 mM KH2PO4, 50 mM glucose) and was centrifuged (37,000g, 30 minutes, 4°C). The F4 layer, composed of proximal tubules, was suspended in culture medium (Dulbecco's modified Eagle's medium/Ham's F-12 medium supplemented with 25 mM Hepes, 25 mM NaHCO3, 4 mM glutamine, 20 nM sodium selenite, 10 ml/l of a 100x nonessential amino acid mixture, 50 U/ml penicillin, 50 µg/ml streptomycin, 10 µg/ml insulin, 5 nM transferrin, 0.1 nM dexamethasone, 10 ng/ml EGF, 5 µg/ml triiodothyronine) and plated at 6, 1, and 0.6 mg of protein in 150- or 60-mm Petri dishes or six-well plates, respectively, that had been coated with collagen type I from calf skin. FCS (5%) was added to the culture medium until the first change of medium (2 days after seeding). The experiments were carried out at day 5.
Tube Formation by Endothelial Progenitor Cells in Matrigel
Flat-bottomed 96-well plates were precoated with a 1:1 mixture of cold Matrigel Basement Membrane (11 mg/ml; BD Biosciences, Bedford, MA, http://www.bdbiosciences.com) and MEM-
(Biowest, Nuaille, France, http://www.biowest.net). After 45 minutes of polymerization at 37°C, EPC were plated at 2 x 104 cells per well in three culture conditions: MEM-
, supernatant of culture MSC, and supernatant of melatonin-pretreated MSC. After 24 hours, tube formation was evaluated under an inverted light microscope by counting the number of polygons formed in the well. All experiments were performed in triplicate.
Renal Function
Plasma creatinine and urea were measured with a Luminex 100 IS system (Luminex Corp, Austin, TX, http://www.luminexcorp.com).
Statistical Analysis
Data are presented as mean ± SEM. Statistical comparison of the data was performed using the t test for comparison between two groups or one-way analysis of variance and the post hoc Tukey test for comparison of more than two groups. A value of p < .05 was considered statistically significant.
 |
RESULTS
|
|---|
Characterization and Labeling of MSCs
MSCs were generated by standard procedures from bone marrow and grown for three passages in culture. MSCs were separated from contaminating hematopoietic cells by their adherence to plastic and were morphologically defined by a fibroblast-like appearance. As shown by flow cytometry analysis, most adherent cells expressed CD90, CD29, and CD106 (MSC antigens) and were negative for CD45, CD34 (hematopoietic antigens), and CD31 (vascular endothelial cells marker) (Fig. 1A). Moreover, immunocytochemistry confirmed that the majority of cells expressed the MSC antigens (Fig. 1A, insets) and did not reveal endothelial or leukocyte antigen labeling.

View larger version (29K):
[in this window]
[in a new window]
|
Figure 1. Characterization and labeling of mesenchymal stem cells (MSCs). (A): Cytofluorimetric and immunochemistry (inset) analysis of MSCs was performed using CD90, CD29, CD106, CD45, CD34, and CD31 antibodies. (B): Upper panel, analysis of the fluorescence associated with QD showing the labeling of MSCs (red line) compared with unlabeling MSCs (dotted line); Lower panel, cell cycle distribution of QD-labeled MSCs. Abbreviations: FITC, fluorescein isothiocyanate; PE, phycoerythrin; QD, Quantum Dots.
|
|
To track MSCs after renal graft, MSCs were labeled with fluorescent inorganic nanocrystals (QD). Recently, QD have been described as a reliable tracking agent for identifying exogenous MSCs in histological sections [32, 33]. As determined by fluorescence-activated cell sorting analysis (Fig. 1B), we showed that 99.7% of MSCs were labeled by QD. A small population of MSCs were actively engaged in proliferation (S + G2 + M = 9%), whereas 91% of cells were in the G0/G1 phases (Fig. 1C), which is in agreement with previous data [34]. In addition, we showed that QD labeling was abolished in dead cells (supplemental online Fig. 1). Taken together, these results indicate that QD appear to be suitable for the tracking and the quantification of living MSCs after intraparenchymal injection.
Effects of Melatonin Pretreatment on Survival of MSCs
In in vivo experiments, we injected 1 million MSCs in three different areas of the kidney (poles and middle area) after 30 minutes of reperfusion. On the basis of previous dose-response experiments, we showed that this amount of cells was the most efficient in decreasing plasma creatinine and urea after ischemia-reperfusion without renal bleeding or early/late animal death (data not shown). Forty-eight hours after intrarenal administration of MSCs, injection sites were detected by hematoxylin staining (Fig. 2A, upper panels). After injection of untreated MSCs (Fig. 2A, left panels), only a few QD fluorescent cells could be detected. In contrast, immunolabeling of histological slides with anti-CD90 antibody revealed an intense fluorescent signal corresponding to the injection site. This suggests that untreated MSCs underwent early death and leak of fluorescent QD after intrarenal injection. Pretreatment of MSCs with melatonin during the 24 hours before injection (Fig. 2A, middle panels; Fig. 2B) induced a significant increase in the number of QD-positive cells that were colabeled by anti-CD90 antibody. The possibility that the increase in QD-positive cells was related to the direct activity of melatonin on the renal environment is unlikely, as MSCs were extensively washed with melatonin-free medium prior to injection. In addition, we showed that simultaneous intraparenchymal administration of melatonin and MSCs gave results similar to those found with untreated MSCs (Fig. 2A, right panels). The increase in MSC survival following melatonin treatment was confirmed by the measure of apoptosis by TUNEL analysis (Fig. 2C, 2D; supplemental online Fig. 2). As shown in Figure 2D, the percentage of apoptotic cells detected at the injection site was significantly lower in melatonin-treated than in untreated cells. Two months after intrarenal administration of MSCs, the injection site was more easily identified in hematoxylin/eosin-stained preparations in animals injected with melatonin-treated cells (Fig. 2Ed, 2Ee) than in kidney injected with untreated MSCs (Fig. 2Ea, 2Eb). The area of injection, distinguished from the classic renal structures, contained a large amount of cells still positive for QD (Fig. 2Ef). Histomorphological analysis of the injected kidneys did not reveal positive staining for Alcian Blue, Sirius red, or alizarin red S, indicating that surviving cells do not promote extracellular matrix accumulation, collagen synthesis, or calcium deposit, respectively (data not shown). These results indicate that intraparenchymal injection of melatonin-treated MSCs allows a "long-term" survival of grafted cells within the kidney.

View larger version (63K):
[in this window]
[in a new window]
|
Figure 2. In vivo effect of melatonin pretreatment on MSC survival. Animals received MSCs, melatonin-pretreated MSCs, or MSCs plus melatonin (without 24-hour pretreatment). (A): Hematoxylin staining (top row), QD fluorescence labeling (red, middle row), and CD90 staining (green, bottom row) (magnification, x200). (B): Quantification of the fluorescence associated with QD-labeled MSCs in the three different groups. (C): TUNEL assay performed within injection sites (magnification, x200). (D): Quantification of TUNEL-positive cells within injection sites in the three different groups. (E): Hematoxylin/eosin staining of histological sections obtained from kidneys 2 months after injection with untreated MSCs (Ea–Ec) or melatonin-treated MSCs (Ed–Ef). (Ea) and (Ed) represent the computerized reconstruction of 12 different images (magnification, x100). The area included within the dotted line identifies the injection site. (Eb), (Ec), (Ee), and (Ef) show a higher magnification of an area within the injection site (magnification, x400). (Ec) and (Ef) show the QD-labeled cells. Abbreviations: MSC, mesenchymal stem cell; QD, Quantum Dots; TUNEL, terminal deoxynucleotidyl transferase dUTP nick-end labeling.
|
|
To gain insight into the mechanisms involved in improving survival of MSCs, we tested the effect of melatonin on cultured MSCs. As a first step, we investigated the expression of MT receptors in rat MSCs. As shown in Figure 3A, MT1 and MT2 mRNAs could be amplified in rat MSCs, indicating that both melatonin receptor subtypes are expressed in these cells. To determine the ability of melatonin to protect MSCs from apoptosis, cultured MSCs were preincubated with melatonin for 24 hours and then challenged with H2O2. As shown in Figure 3B, MSCs incubation with H2O2 (100 and 200 µM) induced a dose-dependent increase in cell apoptosis. This effect was fully (100 µM H2O2) or partially (200 µM H2O2) prevented by preincubation of MSCs with 5 µM melatonin. The antiapoptotic effect of melatonin was partially inhibited by the nonselective MT receptor antagonist luzindole, indicating that the protective activity of melatonin was mediated, in part, by stimulation of MT receptors. One of the potential mechanisms involved in melatonin-mediated protection of MSCs from oxidative damage could be upregulation of antioxidant enzymes. To verify this possibility, we tested the effect of melatonin on the expression of the antioxidant enzyme catalase and Cu/Zn superoxide dismutase (SOD-1). Western blot analysis showed that melatonin treatment of cultured MSCs (5 µM, 24 hours) induced a significant increase in the intensity of the bands corresponding to catalase and SOD-1 (Fig. 3C). As observed for MSCs protection from oxidative damage, the increase in the amount of antioxidant enzymes by melatonin was prevented by the MT receptor antagonist luzindole. These results show that melatonin is able to induce a concomitant overexpression of antioxidant enzymes and protection against the oxidative stress in cultured MSCs.

View larger version (27K):
[in this window]
[in a new window]
|
Figure 3. In vitro effects of melatonin pretreatment on MSC survival. (A): Expression of type 1 and 2 melatonin receptor mRNAs in MSCs. Brain and intestine were used as positive controls for MT1 and MT2 receptor expression, respectively. (B): H2O2 challenge (100 or 200 µM; 24 hours) was performed on melatonin-treated MSCs (5 µM; 24 hours) or untreated MSCs. Apoptotic cells were measured by SYTO-13 assay. (C): Western blot performed using antibodies directed against catalase and SOD-1, respectively. Actin was used as a positive control. Luzindole was used as a nonselective melatonin receptor antagonist (10 µM; 1 hour prior to addition of melatonin). Abbreviations: bp, base pairs; MSC, mesenchymal stem cell; MW, molecular weight; SOD-1, superoxide dismutase.
|
|
Effects of Melatonin Pretreatment on Proangiogenic and Mitogenic Activities of MSCs
Previous studies showed that the beneficial effects of MSCs after ischemia-reperfusion are related, in part, to stimulation of angiogenesis. On the basis of these findings, we next investigated whether the proangiogenic properties of MSCs could be improved by melatonin. Immunolabeling of histological sections with anti-CD31 antibody (Fig. 4, upper panels) revealed a higher number of vascular structures in areas injected with melatonin-treated MSCs (Fig. 4B–4D) compared with zones injected with untreated cells (Fig. 4A, 4D). Similar results were obtained by labeling with von Willebrand factor antibody (Fig. 4E–4H). A higher-magnification image of cortical zones evidenced variable sizes of vessels, with capillaries containing blood, attesting a functional neovascularization of the kidney. Most of the vascular structures also stained positively for actin smooth muscle (supplemental online Fig. 3), indicating that a concomitant increase in endothelial and vascular smooth muscle cells formation was triggered by MSC grafting. It can be noted that anatomical organization of the newly formed vessels was similar to that of the constitutive renal network.

View larger version (67K):
[in this window]
[in a new window]
|
Figure 4. Analysis of angiogenesis and vascular organization after injection of melatonin-treated MSCs. (A–C): Representative images (magnification, x100) of CD31 immunolabeling of area injected with MSC (A) and melatonin-treated MSCs (B, C). (D): Quantitative analysis of the number of functional vessels in the two groups. (E–G): Representative images (magnification, x200) of von Willebrand factor immunolabeling of area injected with MSCs (E) and melatonin-treated MSCs (F, G). (H): Quantitative analysis of the number of functional vessels in the two groups. Abbreviation: MSC, mesenchymal stem cell.
|
|
Interestingly, measurement of cell proliferation by PCNA labeling showed that PCNA-positive cells were detected around the injection site and that their number was significantly higher (+29-fold) in kidneys injected with melatonin-treated cells (Fig. 5A, 5B, 5D) than in kidneys injected with untreated MSCs (Fig. 5C, 5D). This phenomenon was associated with a decrease in the extent of apoptosis in the peri-injection area (data not shown). These results show that injection of MSCs pretreated with melatonin is associated with enhanced proliferation of renal cells.

View larger version (80K):
[in this window]
[in a new window]
|
Figure 5. Analysis of renal cell proliferation after injection of melatonin-treated MSCs. Immunochemistry for PCNA counterstained with H/E showed a positive staining (brown) representative of proliferative cells. (A, C): Representative images of PCNA staining in melatonin-treated MSCs (A) and in untreated MSCs (C). (B): Image reveals QD fluorescence associated with melatonin-treated MSCs (magnification, x400). * indicates the border zone of melatonin-treated MSCs-injected sections (A, B). (D): Quantification of PCNA-positive cells per field. Abbreviations: MSC, mesenchymal stem cell; PCNA, proliferating cell nuclear antigen.
|
|
On the basis of the results obtained in vivo, we next determined whether melatonin was able to stimulate secretion of proangiogenic and mitogenic factors by MSCs in vitro. As shown in Figure 6A, melatonin increased mRNA levels of b-FGF and HGF, whereas mRNAs of VEGF, IGF1, EGF, and G-CSF were unmodified. In melatonin-treated MSCs, the increase in b-FGF and HGF mRNA expression was time-dependent, peaking at 4 hours and then declining to values similar to those of untreated cells. To test the functional relevance of factors secreted by MSCs, conditioned media from melatonin-treated MSCs were tested on primary cultures of EPC or proximal tubule cells (PTC). Supernatants of untreated MSCs increased tube formation by EPC (Fig. 6B) and proliferation of PTC (Fig. 6C) compared with control medium. These effects were significantly increased when EPC and PTC were treated with supernatant from melatonin-preconditioned MSCs. These results demonstrated that ex vivo treatment with melatonin increased the ability of MSCs to produce and secrete angiogenic and proliferative factors.

View larger version (29K):
[in this window]
[in a new window]
|
Figure 6. In vitro effects of melatonin pretreatment on paracrine activity of MSCs. (A): Quantitative reverse transcription-polymerase chain reaction following melatonin treatment (5 µM) showed expression of different cytokines. (B, C): Effects of supernatants from MSCs treated or not treated with melatonin (5 µM; 24 H) on the tube formation by endothelial progenitor cells (B) and on the proliferation of primary culture of PTC (C). (Ba–Bc): Representative phase-contrast images of endothelial progenitor cells in the three conditions. Abbreviations: b-FGF, basic fibroblast growth factor; H, hours; HGF, hepatocyte growth factor; IGF, insulin-like growth factor; MSC, mesenchymal stem cell; PTC, proximal tubule cells; VEGF, vascular endothelial growth factor.
|
|
Effects of Melatonin-Treated MSCs on Renal Function
Renal function was assessed by measuring plasma creatinine and urea before, 48 hours after, and 2 months after ischemia-reperfusion. As shown in Figure 7, plasma creatinine and urea increased 48 hours after ischemia-reperfusion. Intrarenal injection of untreated MSCs after ischemia-reperfusion reduced plasma creatinine and urea. However, only the decrease in plasma urea reached the statistical significance. A further decrease in the two plasma parameters was observed in animals injected with melatonin-treated MSCs. The creatinine and urea values were significantly lower than those of the ischemia-reperfusion and melatonin-untreated MSC groups. These data show that melatonin treatment significantly increased the beneficial effects of MSCs on the short-term recovery of renal function after ischemia-reperfusion. The improvement of renal function was maintained 2 months after MSC administration.

View larger version (24K):
[in this window]
[in a new window]
|
Figure 7. Effect of melatonin pretreatment on renal function. Renal function was evaluated by determining plasmatic creatinine (A) and urea (B) in sham, I/R, untreated MSC, and melatonin-pretreated MSC groups 48 hours or 2 months after cell administration. Abbreviations: I/R, ischemia/reperfusion; MSC, mesenchymal stem cell.
|
|
 |
DISCUSSION
|
|---|
Our results show for the first time that melatonin regulates two properties of MSCs that may be particularly relevant in the field of cell therapy. Indeed, we found that melatonin, at the same time, protects MSCs from apoptosis and promotes secretion of proangiogenic/mitogenic factors. These effects were associated with increased MSC survival after intraparenchymal injection, stimulation of renal cell proliferation, enhancement of angiogenesis, and improvement of renal function.
Although converging evidence suggested that melatonin behaves as a protective agent in different experimental models, its ability to improve survival of MSCs was still unknown. Here we demonstrate that ex vivo melatonin treatment strongly decreases early death of injected MSCs, and this effect persisted up to 2 months after graft. The direct antioxidant activity of melatonin, previously reported for protection of injured organs [26, 27, 35–37], cannot account for the increased survival of grafted MSCs. Indeed, besides the fact that most of melatonin was removed by extensive washing after ex vivo treatment, simultaneous injection of untreated MSCs and melatonin did not improve MSC survival. In contrast, the observation that the protective activity of melatonin required 24 hours of ex vivo treatment strongly suggests that melatonin enhances the intrinsic prosurvival properties of MSCs. This possibility was further supported by in vitro experiments showing that melatonin treatment increased MSC survival after challenging with apoptotic concentrations of H2O2 and promoted overexpression of catalase and SOD-1. These effects did not require the presence of melatonin in the incubation medium, as they were observed after extensive washing of MSCs. Two observations indicate that protection from apoptosis and regulation of antioxidant enzymes by melatonin involved specific melatonin receptors: first, we showed that MSCs express both MT1 and MT2 receptor subtypes; second, the effects of melatonin on H2O2 challenging and catalase/SOD-1 expression were reversed by the MT receptor antagonist luzindole. Taken together, these results show that melatonin, through a receptor-mediated mechanism, is able to enhance the antioxidant defense of MSCs and their resistance to apoptotic insults.
It should be mentioned that in a previous study, MT2 receptors of MSCs were involved in melatonin-mediated regulation of the activity of alkaline phosphatase, a marker of osteoblast differentiation. However, unlike the case in our study, this effect occurred only after long-term incubation of MSCs with melatonin (10 days) and required an osteogenic culture medium. The fact that we did not observe any osteogenic activity of MSCs up to 2 months after their intrarenal injection suggests that in our experimental conditions, the pro-osteoblastic activity of melatonin is unlikely.
The increase in the number of surviving MSCs after grafting was associated with enhanced angiogenesis and proliferation of renal cells, two events known to be involved in acceleration of structural and functional recovery of the kidney after ischemia-reperfusion. A previous study reported that proangiogenic activity of MSCs and their beneficial effects on renal recovery were related to the secretion of paracrine factors. Our results demonstrated that melatonin strongly enhanced the release of angiogenic and mitogenic factors by MSCs. Indeed, conditioned media from melatonin-treated MSCs promoted tube formation by endothelial progenitor cells and increased proliferation of proximal tubule cells. In addition, melatonin stimulated MSC expression of two angiogenic and mitogenic factors, b-FGF and HGF, that have been previously involved in renal protection and repair, mainly by stimulating angiogenesis and regeneration of renal cells [8, 38–40].
The functional relevance of the increase in survival and paracrine activity of melatonin-treated MSCs was confirmed by the analysis of renal function after ischemia-reperfusion. Indeed, we showed that intraparenchymal injection of MSCs accelerated the normalization of plasma creatinine and urea, an effect that was significantly amplified in animals injected with melatonin-treated MSCs.
As compared with other strategies aimed to improve efficiency of stem cells, in particular genetic modification [41–44], melatonin ex vivo treatment presents different advantages in view of a clinical application: first, melatonin combines enhanced cell survival with improved secretion of favorable paracrine factors; second, melatonin is currently used as a diet complement and, at present, no major side effects have been reported. Finally, melatonin can be fully removed before injection without loss of beneficial activity, making the risk of side effects extremely unlikely.
 |
CONCLUSION
|
|---|
Our results show that melatonin behaves as a preconditioning agent increasing survival, paracrine activity, and efficiency of MSCs. The use of this molecule for pretreatment of stem cells may represent a novel and safe approach for improving the beneficial effects of cell therapy of solid organs.
 |
DISCLOSURE OF POTENTIAL CONFLICTS OF INTEREST
|
|---|
The authors indicate no potential conflicts of interest.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Jean-Claude Lepert (Institut National de la Santé et de la Recherche Médicale [INSERM], EA2450, Cytométrie, Toulouse, France) for excellent technical help and Serge Estaque (Service d'anatomie et cytologie pathologiques, Centre Hospitalo-Universitaire Rangueil, Toulouse, France) for assistance in tissue embedding and processing. We also thank the Service de Zootechnie (INSERM, IFR31, Toulouse, France). This work was supported in part by INSERM and by grants from the National Research Agency (Grant under program Physiopathologie des Maladies Humaines, project SYNMESCARI), the Région Midi-Pyrénées, and the Association Française contre les Myopathies.
 |
FOOTNOTES
|
|---|
Author contributions: C.M.: conception and design, collection and/or assembly of data, data analysis and interpretation, manuscript writing; E.T., F.C., M.-D.P.-M., and D. Calise: collection and/or assembly of data, data analysis and interpretation; M.-H.S.: collection and/or assembly of data; F.D.-G. and F.S.: conception and design, data analysis and interpretation, final approval of manuscript; L.D.: data analysis and interpretation; P. Bianchi: conception and design; P. Bourin: conception and design, provision of study material or patients; A.P.: conception and design, data analysis and interpretation, manuscript writing, final approval of manuscript, financial support; D. Cussac: conception and design, data analysis and interpretation, manuscript writing, final approval of manuscript.
 |
REFERENCES
|
|---|
- Beyer Nardi N, da Silva Meirelles L. Mesenchymal stem cells: Isolation, in vitro expansion and characterization. Handb Exp Pharmacol 2006;249–282.
- Jiang Y, Jahagirdar BN, Reinhardt RL et al. Pluripotency of mesenchymal stem cells derived from adult marrow. Nature 2002;418:41–49.[CrossRef][Medline]
- Kassem M, Kristiansen M, Abdallah BM. Mesenchymal stem cells: Cell biology and potential use in therapy. Basic Clin Pharmacol Toxicol 2004;95:209–214.[CrossRef][Medline]
- Pittenger MF, Mackay AM, Beck SC et al. Multilineage potential of adult human mesenchymal stem cells. Science 1999;284:143–147.[Abstract/Free Full Text]
- Morigi M, Imberti B, Zoja C et al. Mesenchymal stem cells are renotropic, helping to repair the kidney and improve function in acute renal failure. J Am Soc Nephrol 2004;15:1794–1804.[Abstract/Free Full Text]
- Kunter U, Rong S, Djuric Z et al. Transplanted mesenchymal stem cells accelerate glomerular healing in experimental glomerulonephritis. J Am Soc Nephrol 2006;17:2202–2212.[Abstract/Free Full Text]
- Tang J, Xie Q, Pan G et al. Mesenchymal stem cells participate in angiogenesis and improve heart function in rat model of myocardial ischemia with reperfusion. Eur J Cardiothorac Surg 2006;30:353–361.[Abstract/Free Full Text]
- Tögel F, Weiss K, Yang Y et al. Vasculotropic, paracrine actions of infused mesenchymal stem cells are important to the recovery from acute kidney injury. Am J Physiol Renal Physiol 2007;292:F1626–F1635.[Abstract/Free Full Text]
- Wu Y, Chen L, Scott PG et al. Mesenchymal stem cells enhance wound healing through differentiation and angiogenesis. STEM CELLS 2007;25:2648–2659.[Abstract/Free Full Text]
- Maurel A, Azarnoush K, Sabbah L et al. Can cold or heat shock improve skeletal myoblast engraftment in infarcted myocardium? Transplantation 2005;80:660–665.[CrossRef][Medline]
- Müller-Ehmsen J, Whittaker P, Kloner RA et al. Survival and development of neonatal rat cardiomyocytes transplanted into adult myocardium. J Mol Cell Cardiol 2002;34:107–116.[CrossRef][Medline]
- Reinecke H, Zhang M, Bartosek T et al. Survival, integration, and differentiation of cardiomyocyte grafts: A study in normal and injured rat hearts. Circulation 1999;100:193–202.[Abstract/Free Full Text]
- Tambara K, Sakakibara Y, Sakaguchi G et al. Transplanted skeletal myoblasts can fully replace the infarcted myocardium when they survive in the host in large numbers. Circulation 2003;108(suppl 1):II259–II263.[Medline]
- Toma C, Pittenger MF, Cahill KS et al. Human mesenchymal stem cells differentiate to a cardiomyocyte phenotype in the adult murine heart. Circulation 2002;105:93–98.[Abstract/Free Full Text]
- Niagara MI, Haider H, Jiang S et al. Pharmacologically preconditioned skeletal myoblasts are resistant to oxidative stress and promote angiomyogenesis via release of paracrine factors in the infarcted heart. Circ Res 2007;100:545–555.[Abstract/Free Full Text]
- Qu Z, Balkir L, van Deutekom JC et al. Development of approaches to improve cell survival in myoblast transfer therapy. J Cell Biol 1998;142:1257–1267.[Abstract/Free Full Text]
- Suzuki K, Murtuza B, Beauchamp JR et al. Dynamics and mediators of acute graft attrition after myoblast transplantation to the heart. FASEB J 2004;18:1153–1155.[Abstract/Free Full Text]
- Suzuki K, Smolenski RT, Jayakumar J et al. Heat shock treatment enhances graft cell survival in skeletal myoblast transplantation to the heart. Circulation 2000;102:III216–III221.[Medline]
- Tang YL, Tang Y, Zhang YC et al. Improved graft mesenchymal stem cell survival in ischemic heart with a hypoxia-regulated heme oxygenase-1 vector. J Am Coll Cardiol 2005;46:1339–1350.[Abstract/Free Full Text]
- Vanecek J. Cellular mechanisms of melatonin action. Physiol Rev 1998;78:687–721.[Abstract/Free Full Text]
- Cardinali DP, Brusco LI, Lloret SP et al. Melatonin in sleep disorders and jet-lag. Neuro Endocrinol Lett 2002;23(suppl 1):9–13.
- Pévet P. Melatonin and biological rhythms. Biol Signals Recept 2000;9:203–212.[CrossRef][Medline]
- Skwarlo-Sonta K. Melatonin in immunity: Comparative aspects. Neuro Endocrinol Lett 2002;23(suppl 1):61–66.[Medline]
- Garcia-Mauriño S, Gonzalez-Haba MG, Calvo JR et al. Melatonin enhances IL-2, IL-6, and IFN-gamma production by human circulating CD4+ cells: A possible nuclear receptor-mediated mechanism Involving T helper type 1 lymphocytes and monocytes. J Immunol 1997;159:574–581.[Abstract]
- Reiter RJ, Tan DX, Gitto E et al. Pharmacological utility of melatonin in reducing oxidative cellular and molecular damage. Pol J Pharmacol 2004;56:159–170.[Medline]
- Reiter RJ, Tan DX, Mayo JC et al. Melatonin as an antioxidant: Biochemical mechanisms and pathophysiological implications in humans. Acta Biochim Pol 2003;50:1129–1146.[Medline]
- Reiter RJ, Tan DX, Osuna C et al. Actions of melatonin in the reduction of oxidative stress. A review. J Biomed Sci 2000;7:444–458.[Medline]
- Bandyopadhyay D, Chattopadhyay A. Reactive oxygen species-induced gastric ulceration: Protection by melatonin. Curr Med Chem 2006;13:1187–1202.[CrossRef][Medline]
- Welin AK, Svedin P, Lapatto R et al. Melatonin reduces inflammation and cell death in white matter in the mid-gestation fetal sheep following umbilical cord occlusion. Pediatr Res 2007;61:153–158.[CrossRef][Medline]
- Vinay P, Gougoux A, Lemieux G. Isolation of a pure suspension of rat proximal tubules. Am J Physiol 1981;241:F403–F411.[Medline]
- Basire A, Sabatier F, Ravet S et al. High urokinase expression contributes to the angiogenic properties of endothelial cells derived from circulating progenitors. Thromb Haemost 2006;95:678–688.[Medline]
- Muller-Borer BJ, Collins MC, Gunst PR et al. Quantum dot labeling of mesenchymal stem cells. J Nanobiotechnology 2007;5:9.[CrossRef][Medline]
- Rosen AB, Kelly DJ, Schuldt AJ et al. Finding fluorescent needles in the cardiac haystack: Tracking human mesenchymal stem cells labeled with quantum dots for quantitative in vivo three-dimensional fluorescence analysis. STEM CELLS 2007;25:2128–2138.[Abstract/Free Full Text]
- Conget PA, Minguell JJ. Phenotypical and functional properties of human bone marrow mesenchymal progenitor cells. J Cell Physiol 1999;181:67–73.[CrossRef][Medline]
- Hardeland R. Antioxidative protection by melatonin: Multiplicity of mechanisms from radical detoxification to radical avoidance. Endocrine 2005;27:119–130.[CrossRef][Medline]
- Kunduzova OR, Escourrou G, Seguelas MH et al. Prevention of apoptotic and necrotic cell death, caspase-3 activation, and renal dysfunction by melatonin after ischemia/reperfusion. FASEB J 2003;17:872–874.[Abstract/Free Full Text]
- Lagneux C, Joyeux M, Demenge P et al. Protective effects of melatonin against ischemia-reperfusion injury in the isolated rat heart. Life Sci 2000;66:503–509.[CrossRef][Medline]
- Efthimiadou A, Lambropoulou M, Pagonopoulou O et al. The role of basic-fibroblast growth factor (b-FGF) in cyclosporine-induced nephrotoxicity. In Vivo 2006;20:265–269.[Abstract/Free Full Text]
- Ryan JM, Barry FP, Murphy JM et al. Mesenchymal stem cells avoid allogeneic rejection. J Inflamm (Lond) 2005;2:8.[CrossRef][Medline]
- Xin X, Yang S, Ingle G et al. Hepatocyte growth factor enhances vascular endothelial growth factor-induced angiogenesis in vitro and in vivo. Am J Pathol 2001;158:1111–1120.[Abstract/Free Full Text]
- Dzau VJ, Gnecchi M, Pachori AS. Enhancing stem cell therapy through genetic modification. J Am Coll Cardiol 2005;46:1351–1353.[Free Full Text]
- Gnecchi M, He H, Liang OD et al. Paracrine action accounts for marked protection of ischemic heart by Akt-modified mesenchymal stem cells. Nat Med 2005;11:367–368.[CrossRef][Medline]
- Gnecchi M, He H, Noiseux N et al. Evidence supporting paracrine hypothesis for Akt-modified mesenchymal stem cell-mediated cardiac protection and functional improvement. FASEB J 2006;20:661–669.[Abstract/Free Full Text]
- Mangi AA, Noiseux N, Kong D et al. Mesenchymal stem cells modified with Akt prevent remodeling and restore performance of infarcted hearts. Nat Med 2003;9:1195–1201.[CrossRef][Medline]